Mapping the functional domain of the prion protein Taian Cui 1 , Maki Daniels 2 , Boon Seng Wong 3 , Ruliang Li 3 , Man-Sun Sy 3 , Judyth Sassoon 1 and David R. Brown 1,2 1 Department of Biology and Biochemistry, University of Bath, UK; 2 Department of Biochemistry, Cambridge University, UK; 3 Institute of Pathology, Case Western Reserve University School of Medicine, Cleveland, Ohio, USA Prion diseases such as Creutzfeldt–Jakob disease are pos- sibly caused by the conversion of a normal cellular glyco- protein, the prion protein (PrP c ) into an abnormal isoform (PrP Sc ). The process that causes this conversion is unknown, but to understand it requires a detailed insight into the normal activity of PrP c . It has become accepted from results of numerous studies that PrP c is a Cu-binding protein and that its normal function requires Cu. Further work has suggested that PrP c is an antioxidant with an activity like that of a superoxide dismutase. We have shown in this investigation that this activity is optimal for the whole protein and that deletion of parts of the protein reduce or abolish this activity. The protein therefore contains an active domain requiring certain regions such as the Cu-binding octameric repeat region and the hydrophobic core. These regions show high evolutionary conservation fitting with the idea that they are important to the active domain of the protein. Keywords: copper; Creutzfeldt–Jakob disease; oxidative stress; scrapie; superoxide dismutase. Neurodegenerative diseases are a major threat to human health. One group of disease termed prion diseases [1,2] make up a small percentage of all human neurodegenerative diseases. Prion diseases have become a major concern because of the possibility that one particular from, variant Creutzfeldt–Jacob disease (vCJD), might arise through transmission of an animal disease, such as bovine spongi- form encephalopathy [3], to humans [4]. Other prion diseases include the sheep disease scrapie [5] and inherited forms such as Gerstmann–Stra ¨ ussler–Scheinker syndrome [6]. All of these disease are linked together because of the deposition of an abnormal, protease-resistant isoform of the prion protein in brains of individuals with these diseases. This abnormal form of the protein (PrP Sc ) is also suggested to be the infectious agent in the disease on the basis of infection studies [2]. PrP Sc is generated from the normal cellular isoform of the prion protein (PrP c ) which is present in the brain as a cell surface glycoprotein [7]. Each form has distinct properties [8]. Therefore understanding the basis of prion disease revolves around understanding how the normal protein is converted to the abnormal isoform. This conversion involves a switch in conformation from a structure rich in a helices to one rich in b-sheet [9]. Although there have been many studies with PrP Sc the study of PrP c has been limited until recently. As an evolutionarily conserved glycoprotein [10] it has been postulated that PrP c has an important function. Nevertheless, knockout mice for PrP c show no gross changes in terms of development or behaviour [11] but cannot be infected with mouse-passaged scrapie [12]. In contrast to this biochemical and cell biological studies have suggest that PrP-knockout mice have compromised cellular resistance to oxidative stress [13,14]. The first clue to the molecular function of PrP c came from studies that show PrP c to be a Cu-binding protein [15–20]. The main Cu-binding site of the protein was shown to be within a conserved octameric repeat region, rich in histidine, located in the N terminus [10]. PrP c binds up to four atoms of Cu at these sites with a possible fifth binding site located elsewhere in the molecule [16,18,21]. Cellular expression of PrP c also facilitates Cu uptake by neurones [22] and increased extracellular Cu causes an increased turnover of PrP c [23]. Binding of Cu to the protein influences its ability to interact with other proteins such as plasminogen [24] and glycosaminoglycans [25]. Knockout of PrP c causes a decrease in cellular resistance of neurones to oxidative stress [13,14,26]. This has lead to suggestions that PrP c might be an antioxidant. Immuno- depletion of PrP c from the brain extracts leads to a reduction in superoxide dismutase (SOD) activity within the extract [27]. Studies with both recombinant protein and native protein purified from the brains of mice suggest that PrP c can act as a SOD [17,28]. This activity is high and requires specific binding of Cu to the octameric repeats. Binding of Cu elsewhere in the protein, or Cu simply to a peptide based on the octameric repeats does not result in this activity [28]. Cellular resistance to oxidative stress is influenced by the PrP c protein and the amount of Cu bound to it [17]. Allelic differences in mouse PrP c have also been shown to influence the level of the activity of the protein, as protein with the sequence of the mouse ÔbÕ allele is more Correspondence to D. R. Brown, Department of Biology and Bio- chemistry, University of Bath, Calverton Down, Bath, BA2 7AY, UK. Fax: +44 1225 826779, Tel.: +44 1225 323133, E-mail: bssdrb@bath.ac.uk Abbreviations: CJD, Creutzfeldt–Jacob disease; vCJD, variant Creutzfeldt–Jacob disease; PrP c , prion protein; PrP Sc ,abnormal isoform of prion protein; rPrP, recombinant mouse prion protein; SOD, superoxide dismutase. (Received 28 April 2003, revised 5 June 2003, accepted 11 June 2003) Eur. J. Biochem. 270, 3368–3376 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03717.x active than that based of the sequence of the ÔaÕ allele [29]. In contrast, PrP Sc , which binds almost no Cu has no detectable SOD activity [30,31]. Proteins that are enzymes normally have active sites that are essential for the enzymatic activity. In this study we used both a panel of highly specific antibodies and a series of deletion mutants of recombinant PrP to determine which regions of the protein are necessary for the SOD activity. We determined that the active site consists of two domains. The first includes the Cu-binding domain and the second includes the conserved hydrophobic domain in the middle of the protein. Additionally, the C terminus of the protein is important for this activity. Experimental methods Production of recombinant protein Production of recombinant mouse prion protein (rPrP) has been described previously [28]. Briefly, PCR amplified product was cloned in the expression vector, pET-23 (Novagen) and transformed into Escherichia coli AD 494(DE3). The expressed proteins were recovered from urea solubilized, sonicated bacterial lysate after using immo- bilized nickel-based affinity chromatography (Invitrogen). The eluted material was refolded by several successive rounds of dilution in either deionized water or 1 m M CuSO 4 fol- lowed by ultrafiltration and dialysis to remove unbound Cu. The final protein was typically >95% pure and was concen- trated to 1–2 mgÆmL )1 . Its identity was confirmed by N-terminal sequencing and Western blotting using the poly- clonal antibody to mouse PrP (DR1). Protein concentration was determined using the Sigma BCA protein assay reagent. Mutagenesis Deletion mutants of the rPrP were prepared using a PCR based mutagenesis procedure involving paired oligonucleo- tides to either insert an additional restriction site or to delete a proportion of the gene sequence. Mutagenesis was confirmed by DNA sequencing. The mouse PrP ORF was inserted between the Nde1site(5¢)andtheXho1site(3¢). An additional Xho1 site was inserted either after codon 171, or codon 112. Removal of an Xho1fragmentbyenzymatic digestion and subsequent ligation created the deletion mutants PrP23–112 and PrP23–171. A similar procedure was used to produce PrP45–231, PrP90–231, PrP105–231 and PrP113–231. In this case an Nde1 site was inserted before codon, 45, 90, 105 and 113, respectively. Paired primers were also used in mutagenesis experiments to generate deletions of codons 35–45 (PrPD34–45), 112 to136 (PrPD112–136) and 135–150 (PrPD135–150). The oligo- nucleotides used in these mutagenesis experiments are listed in Table 1. Other prion protein mutations generated in a similar way were as described previously [28,32,33]. Protein for these deletion mutants was expressed, purified and refolded as described above for wild-type protein. SOD assays SOD-like activity of recombinant PrP (1 lgÆmL )1 )was determined using the xanthine/xanthine oxidase/nitro-blue tetrazolium (NBT) assay as described before [28]. This assay uses superoxide production from xanthine oxidase and xanthine and detection of a coloured formazan product formed from nitro-blue tetrazolium at 560 nm. The SOD-like activity was expressed as percentage inhibi- tion of formazan produced where 100% formazan product formation is the amount of nitro-blue tetrazolium reduced by xanthine oxidase-formed radicals in control reactions without brain extracts or affinity-purified PrP. All assays were performed in triplicate. The proteins used were tested for their ability to reduce nitro-blue tetrazolium in the absence of xanthine oxidase. None of the proteins showed any reduction of nitro-blue tetrazolium to form formazan as measured spectrophotometrically for 5 min. Also, xanthine oxidase was driven to reduce nitro-blue tetra- zolium aerobically by the addition of 50 l M xanthine to the reaction mixture. A second gel-based assay was also used to detect SOD activity. Proteins (5–20 lg) were electro- phoresed on a 7% polyacrylamide gel without SDS or reducing agents. After electrophoresis, the gel was soaked in a solution of 5 m M nitro-blue tetrazolium at room temperature with rocking for 20 min The gel was then rinsed briefly with distilled water and a developing solution (30 l M riboflavin, 30 m M tetramethylethylenediamine, 40 m M potassium phosphate pH 7.8) for 15 min. At this point the gel was exposed to the light until a uniform blue colour covered the gel. Protein with SOD reactivity leaves the gel transparent. However, if the reaction was allowed to proceed indefinitely the contrast between these regions would be lost. Western blotting Purified proteins were electrophoresed on a 15% polyacryl- amide gel in the presence of SDS and reducing agents. Proteins were blotted onto polyvinylidene fluoride (PVDF) membrane and protein detected by a specific polyclonal (DR1) or monoclonal (DM3) antibody as described previ- ously [32]. This allowed verification of the size and identity of these proteins. Table 1. Mutagenesis oligonucleotides. Only forward oligonucleotides are listed. The reverse oligonucleotide of the splint pair had the com- plementary sequence. Prion protein generated Oligonucleotide PrP23–112 GCATGTGGCAGGGCTCGAGGCAGCTGGGGC PrP23–171 GCAACCAGCTCGAGTTCGTGCACG PrP45–231 GGGAAGCCATATGGGCAACCG PrP90–231 GCCCCATGGCGGTGGATGGCATATGGGAGG GGGTACCC PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC TCAAGC PrP113–231 CCAACCTCAAGCATATGGCAGGG PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC PrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGC PrPD135–150 GCGCCGTGAGCGAAAACATGTACCGC Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3369 CD spectroscopy CD spectra were recorded for prion proteins and peptides using a Jasco J-810 spectropolarimeter, calibrated with ammonium d-camphor-10-sulfonate by a method similar to that described previously [27]. Protein solutions were prepared to contain 2 mgÆmL )1 in 10 m M sodium phos- phate pH 7.4. These samples were measured in cuvettes of 1 mm or 0.5 mm pathlength (Hellma). The spectrum from 190 nm to 250 nm was analysed with step resolution of 0.5 nm at a temperature of 23 °C. Five scans were averaged and the buffer background was subtracted. Spectra are presented as molar ellipticity (h). Results Antibody inhibition of PrP SOD-like activity A panel of highly specific monoclonal antibodies and polyclonal antisera were generated against mouse PrP and have been described previously [32,34–36]. The epitopes of these antibodies have been mapped and are listed in Table 2. The activity of wild-type PrP is like that of a SOD and this activity can be measured by a number of assays. The most robust and accessible method for such a study uses spectrophotometric analysis. We used an assay based on formazan production from nitro-blue tetrazolium by superoxide generated by xanthine oxidase and xanthine. SOD activity inhibits formazan production in the assay by breaking down superoxide. This assay was used to measure the activity of wild-type PrP. A concentration of 0.5 lgÆmL )1 PrP was found to inhibit 70% of the formazan production in the assay. This concentration was used in further experiments in which antibodies or antisera were added in conjunction with PrP to the SOD assay. The results of these experiments are shown in Fig. 1. Several of the antibodies and antisera caused a concentration- dependent inhibition of the SOD-like activity of PrP. The ability of the antibodies and antiserum to inhibit the SOD- like activity of PrP is sumarized in Table 2. Antibodies and antisera are listed according to the epitope to which they bind. It can be clearly seen that the antibodies and antisera that inhibit PrP’s activity are clustered around two parts of the protein. The first cluster is in the N terminus. The second cluster is focused on the hydrophobic domain, residues 112–145. Two antibodies that bind to the C terminus also had a minor inhibitory effect on the SOD- like activity of PrP. Production of deletion mutants of PrP On the basis of the results with antibodies, a series of PrP mutants were made to assess whether deletions of certain domains of the protein decrease the SOD-like activity of the protein. The domains deleted were based on the epitopes of the antibodies that had a clear effect on SOD-like activity of PrP. The mutants used in the study include the complete N- and C-terminal fragments (PrP23–112 and PrP113–231), deletions of the octameric repeat region (PrPD51–89, PrPD67–89), deletions of the hydrophobic domain (PrPD112–119, PrP112–136, PrP135–150), deletions of parts of the N terminus (PrP90–231, PrP45–231, PrPD35–45, PrP) and deletions of the C-terminal domain (PrP23–171). These proteins are illustrated in Fig. 2. A number of these proteins have been studied [28,32]. The identity of the proteins was verified by Western blot with specific antibodies (Fig. 3). SOD-like activity of PrP deletion mutants The activity of the PrP mutant proteins were compared to that of the wild-type recombinant PrP using two assays that have been widely used to detect SOD activity. An in-gel assay (Fig. 4) and a spectrophotometric assay (Fig. 5) detected high levels of activity in wild-type protein. How- ever, most of the mutations tested showed either no activity or reduced activity. A summary of these findings is shown in Table 3. Some results from previously published work are included for completeness. The in-gel assay showed visually that wild-type PrP has strong activity while the mutants PrPD35–45, PrP23–171, PrPD112–119 and PrP45-231 had reduced activity. PrPD112–136 had no activity. The spec- trophotemetric assay was performed (Fig. 5) with increasing concentrations of protein from all the mutants. It should be kept in mind that for mutants with large deletions the concentration of 5 lgÆmL )1 represents a higher molar concentration than wild-type protein. However, these proteins except for PrP23–171 were inactive in the assay. All mutants lacking the octameric repeat region were inactive. Most of the mutants with small deletions showed some activity except PrPD112–136. This mutant was completely inactive. Of considerable interest was the mutant PrP23–171 which despite a lack of a large amount of the C terminus did show some activity. To test the stability of this activity a time-course study was carried out to compare the activity of this protein to wild-type PrP. The proteins were Table 2. Epitopes of antibodies and antisera used in the investigation of PrP activity. Numbers relate to the amino acid residue sequence of mouse prion protein. ÔConformationalÕ implies antibodies that bind to the C terminus of the protein (145–231). The affinity of these anti- bodies is sensitive to the conformation adopted by the protein. Antibody name Epitope Ability to Inhibit Activity 5B2 35–52 + + 8B4 34–45 + + DR3 37–53 + + DM1 68–84 + + + DR1 89–103 + + DR2 94–109 – 5C3 90–145 – 11G5 115–130 + + + DM2 121–136 + + 7H6 130–140 + + DM3 142–160 + 2G8 149–165 – 2C2 153–165 – 8H4 175–185 – 6H3 Conformational – 9H7 Conformational – 7A9 Conformational + 1C10 Conformational + 3370 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003 added to the assay mixture at time zero and the activity measured for 60 s. After this time the activity of the protein was measured repeatedly at regular intervals for the next hour (Fig. 5D). Where as wild-type PrP maintained its activity over the hour, PrP23–171 lost the majority of its activity over the same time period. CD analysis of PrP mutants In order to determine if deletion of critical regions of PrP caused loss of activity because of structural alterations, the deletion mutants were studied using CD spectroscopy. The spectra produced are shown in Fig. 6. Of key interest were those with minimal deletions of protein sequence which caused significant reduction in activity of the protein. The majority of the deletion mutations did not cause significant changes in the structure of PrP. As suggested from previous publications the N terminus (PrP23–112) showed a spec- trum typical of a random coil (Fig. 6E). All other spectra demonstrated predominantly helical content. Interestingly, PrP23–171, which has deletions of two of the helical domains of the PrP protein, also possessed a high content of helical structure. Activity domains of PrP This body of research has provided two sets of results concerning regions of the prion sequence necessary for its 100010010 0 20 40 60 80 100 120 5B2 8B4 DM1 5C3 11G5 DM2 DM3 C [Antibody] in ng/ml % Control SOD-like Activity 100010010 0 20 40 60 80 100 7H6 2G8 2C2 8H4 6H3 9H7 7A9 1C10 B [Antibody] in ng/ml % Control SOD-like Activity 100010010 0 20 40 60 80 100 DR3 DR1 DR2 A Antiserum Dilution % Control SOD-like Activity Fig. 1. Antibodies. The activity of wild-type recombinant mouse PrP was tested using a spectrophotometric assay based on the conversion of nitro-blue tetrazolium to a coloured formazan product by super- oxide generated from xanthine oxidase. PrP (0.5 lgÆmL )1 )wasusedin the assay which inhibited the reaction by 70% (see Fig. 5). Anti- bodies and antisera were then tested for ability to block the effect of PrP. PrP activity in the presence of the antibodies was expressed as a percentage of the activity of PrP alone. Thus, decreased percentage of control activity indicates inhibition of PrP. (Top) Effect of three antisera of equivalent titre. Middle and bottom graphs show effects of 15 monoclonal antibodies. Shown are the mean and SEM of at least three experiments. PrP23-231 PrP23-112 PrP23-171 PrP45-231 PrP90-231 PrP105-231 PrP113-231 PrP∆35-45 PrP∆51-89 PrP∆51-67 PrP∆112-119 PrP∆112-136 PrP∆135-151 23 231 23 112 171 45 90 105 113 35 51 89 67 119 136 135 150 231 231 231 231 231 231 231 231 231 231 112 112 51 45 23 23 23 23 23 23 Fig. 2. Mutant proteins. Mutants of PrP were prepared using PCR- based mutatagenesis and restriction digestion/ligation. The mutations were deleted in parts of the protein that would possibly reduce the activity of PrP based on results shown in Fig. 1 and Table 2. Schematic locations of the deletions as compared with the wild-type protein are shown by a space within the grey bar next to the name of the protein. Numbers refer to the amino acid residues in the mouse PrP sequence. Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3371 function. Results of the use of antibodies on wild-type protein and deletion mutants indicate the relative importance of these domains to PrP’s SOD-like activity. Comparison of data presented in Tables 2 and 3 indicates that there are principally two domains that are necessary for this activity. The first is the Cu-binding domain otherwise known as the octameric repeat region. The second is the hydrophobic domain in the centre of the molecule. A third domain in the N-terminal region before the Cu-binding domain also has a strong influence on activity. Further analysis indicates that the C terminus influences the activity to some extent but is not essential. Collectively, these results suggest that the activity of PrP c requires N- and C-terminal domains which might interact to form the active site. These results are summarized in Fig. 7. Fig. 3. Western blotting. Wild-type mouse PrP and nine of the deletion mutants described were electrophoresed on a 15% polyacrylamide gel and transferred to a membrane. PrP was detected by using the antisera DR1 which detects all of the mutants shown. 1, Wild-type PrP; 2, PrP23–231; 3, PrP23–171, 4; PrPD35–45; 5, PrPD135–150; 6, PrPD112–119; 7, PrP90–231; 8, PrPD51–89; 9, PrP45–231; 10, PrPD112–136. Fig. 4. In-gel assay. An in-gel assay was used to provide a visual demonstration of the SOD-like activity of wild-type PrP and some of the active mutants. Five lg protein was electrophoresed on a native polyacrylamide gel and stained for SOD-like activity. 1, Wild type PrP protein; 2, PrPD35–45; 3, PrPD112–136; 4, PrP23–171; 5 PrPD112–119; 6, PrP45–231. 706050403020100 0 20 40 60 80 100 D Time in minutes % Zero Time Value 100101.1.01 0 20 40 60 80 100 B [Protein] in µg % Inhibition of Formazan Production 100101.1.01 0 20 40 60 80 100 A [Protein] in µg % Inhibition of Formazan Production 100101.1.01 0 20 40 60 80 100 C [Protein] in µg % Inhibition of Formazan Production Fig. 5. Activity of deletion mutants. The nitro-blue tetrazolium/xan- thine/xanthine oxidase assay for SOD activity was used to assess the affect of deletions on the activity of recombinant PrP. (A) Wild-type PrP (d), PrP23–171 (s), PrP45–231 (h), PrP90–231 (j) PrP23–112 (s) and PrP105–231 (n). (B) Wild-type PrP (d), PrP113–231 (s), PrPD35–45 (h), PrPD51–89 (j)PrPD67–89 (s). (C) Wild-type PrP (d), PrPD112–119 (s), PrPD135–150 (h), PrPD112–136 (j). Shown are the mean and and standard errors for at least three separate experi- ments. (D) The activity of wild-type PrP (d) and PrP23-171 (s)were recorded over time. One lg protein was added to the nitro-blue tetra- zolium/xanthine oxidase assay mixture and measured for SOD-like activity in terms of inhibition of formazan production. From this zero time point the SOD-like activity was remeasured 5, 15, 30, 45 and 60 min later. Results are expressed as a percentage of the time zero value at 560 nm. Shown are the mean and SEM for at least three separate experiments. Table 3. Relative activity of PrP deletion mutants. Activity relative to the wild-type PrP is indicated by the number of + signs: +++++, activity equivalent to wild type; –, no activity. Recombinant protein is not glycosylated but native protein has equivalent activity to recom- binant protein [17]. Reactive cleavage of the disulfide bond has been shown to decrease the activity of PrP [48]. PrP deletion mutant Relative activity PrP23-112 – PrP23-171 + + PrP45-231 + + + PrP90-231 – PrP105-231 – PrP113-231 – PrPD35–45 + + PrPD51–89 – PrPD67–89 – PrPD112–119 + + PrPD112–136 – PrPD135–150 ++++ No disulfide bridge + + + Glycosylation +++++ 3372 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Discussion The prion protein is a Cu-binding protein. Early estimates of the affinity of Cu for PrP c suggested that binding of Cu was within the micromolar range [15,16]. Assessment of PrP c -mediated Cu uptake suggested that PrP c influences Cu distribution within the nanomolar range [22]. The implica- tion of this is an affinity between Cu and PrP c in the nanomolar range or lower. Recent studies have also suggested that the affinity of Cu for PrP c could be in the femtomolar range [18]. Despite these inconsistencies, the conclusion that PrP c is a Cu-binding protein is widely accepted. The implication of this is that PrP c is somehow involved in Cu metabolism. Cu in the body is tightly linked to redox chemistry and regulation of the balance between the use of oxygen in respiration and possible oxidative damage. Thus, without further consideration PrP c is implicated in regulation of cellular resistance to oxidative stress. However, there is also considerable evidence that PrP c is an antioxidant [14]. This was first suggested in 1995 [13]. Much of this evidence comes from studies of PrP knockout mice. Changes including electrophysiological parameters [37] and altered sleeping patterns [38] in PrP knockout mice have been linked to loss of antioxidant protection [39,40]. PrP knockout mice are also more susceptible to kindling agents [41]. The effect of such agents is related to the induction of oxidative stress [14]. Cultured cells are also more susceptible to oxidative stress when they lack PrP c expression [13,24,42,43]. PC12 cells expressing increased levels of PrP c are more resistant to oxidative stress [44]. These findings were further clarified when it was shown that recombinant and native PrP c can act as superoxide dismutase [17,28]. Subsequently it has been shown that this activity is dependent of the Cu binding of the protein [45]. Transfection of cells to express PrP c increases their ability to reduce intracellular levels of oxidants [43]. Depletion of PrP c from cells reduces their total superoxide dismutase activity [27]. Loss of PrP c expression by cells is compensated for by specific up-regulation of other SODs including manganese SOD [46] and extracellular SOD [14]. Therefore there is a strong body of evidence linking PrP c to SOD-like activity. Although some scepticism about the antioxidant function of PrP c remains [47,48], there are sufficient data to consider this as a potentially important enzymatic function of this protein. Data presented in this work verifies the previous findings that PrP c is a SOD. Two separate assays confirm this suggestion. That the recombinant protein was effective in the in-gel assay also verifies that the protein is not a weak SOD-like protein but one with equivalent catalytic ability to that of cytoplasmic Cu/Zn SOD. The specific activity of PrP has been shown previously to be about 10-fold less than that of Cu/Zn SOD [28]. However, this Cu/Zn SOD is widely recognized as a very potent catalyst given its ability to catalyse a reaction that would spontaneously occur in minutes or less, in the presence of sufficient concentration of superoxide, in the absence of the enzyme [49]. Analyses of domains in this protein necessary for the SOD-like activity used both deletion mutants and antibod- ies that recognized known epitopes. In particular antibodies DM1 and 11G5 showed the strongest inhibition of the 250245240235230225220215210205200195190 -14 -12 -10 -8 -6 -4 -2 0 2 E Wavelength in nm Molar Elipticity ( ) θθ θθ 250245240235230225220215210205200195190 -6 -4 -2 0 2 4 6 8 G Wavelength in nm Molar Elepticity ( ) θθ θθ 250245240235230225220215210205200195190 -3 -2 -1 0 1 2 3 H Wavelength in nm 250245240235230225220215210205200195190 -8 -6 -4 -2 0 2 4 6 8 B Wavelength in nm 250245240235230225220215210205200195190 -8 -6 -4 -2 0 2 4 6 8 D Wavelength in nm 250245240235230225220215210205200195190 -6 -4 -2 0 2 4 6 8 F Wavelength in nm 250245240235230225220215210205200195190 -6 -4 -2 0 2 4 6 8 C Wavelength in nm Molar Elipticity ( ) θθ θθ 250245240235230225220215210205200195190 -8 -6 -4 -2 0 2 4 6 8 A Wavelength in nm Molar Elipticity ( ) θθ θθ Molar Ell ipticity (θθ θθ )Molar Ellipticity (θθ θθ )Molar Ellipticity (θθ θθ )Molar Ellipticity (θθ θθ ) Fig. 6. CD of PrP mutants. Wild-type and mutant PrPs were studied by CD spectroscopy. (A) Wild-type PrP. (B) PrPD35–45. (C) PrPD112–119. (D) PrP51–89. (E) PrP23–112. (F) PrPD135–150. (G) PrPD112–136. (H) PrP23–171. Spectra are shown as molar ellipticity (h). s s Necessary Domains 123 231 252 51 90 112 145 178 213 N N 35 Minor Domain Important Domain Important Domain Signal Sequence Octameric Repeats Hydrophobic Domain GPI Anchor Signal Fig. 7. Summary. This schematic diagram, based on the results from all experiments, shows those regions of the PrP protein necessary for the SOD-like activity with Cu bound. Black bars are essential for activity; grey bars show those regions that also play a role but are not essential; hatched bar indicates that the C-terminal part of PrP cor- responding to the last two helices can also influence the activity of the protein but are not essential. Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3373 protein’s activity of suggesting that both the octameric repeat region and the hydrophobic domain were critical for the activity of the protein. This was confirmed by deletion mutations that showed lack of SOD-like activity when these regions were deleted. Experiments using three other antibodies binding near the residues 35–45 also suggested that this region was important. Deletion of these residues confirmed this finding. Assays using the antibodies 7H6 and DM3 also indicated that residues 130–160 might also play a role in the activity. However deletion of residues 135–150 had no affect at all on the activity suggesting this domain is not involved in the activity of the protein. This deletion also served as a good negative control showing that deletion of part of PrP need not inhibit the SOD-like activity if it is made outside the domains essential for this activity. Inhibition of activity by two antibodies that were sensitive to the conformation of the C terminus indicated that the conformation of the C terminus is important to the activity of the protein. Deletion of the whole C terminus rendered the protein inactive but surprisingly deletion of only the last two helices (PrP23–171) did not lead to inactive protein. Further analysis indicated that this mutant was labile in its activity and rapidly lost activity when continually exposed to superoxide. This mutant was highly soluble and con- tained surprisingly high helical content. One possibility is that the N terminus of the protein does not contain a totally unordered structure when associated with at least one helix of the C terminus. This would contradict findings from NMR studies suggesting there is no structure in the N terminus [50]. We have also observed the lack of regular secondary structure along the N terminus with CD analysis but again this might be different when associated with other domains of the protein. Our findings concerning the C-terminal domain support what was shown previously. Preventing the formation of the disulfide bridge in the last two helices reduces the activity of PrP [51]. Thus, although these regions are not essential for the manifestation of the activity they are important to maintaining that activity. Further evidence for this comes from work with the different mouse alleles of the protein. It was found that protein generated from the mouse ÔbÕ allele has higher activity from that of the ÔaÕ allele [29]. These alleles differ only in two amino residues one of which is residue 189 in the second helix. That the octameric repeat region of the protein is necessary for SOD function is clear from the fact that this is the main Cu-binding region of the protein. Although it has been suggested that Cu binds elsewhere in the molecule [18,21] it is not clear if this occurs in vivo and may only occur under nonphysiological conditions or when the N-terminal region has been cleaved off. How- ever, PrP90–231 which is equivalent to the protein studied by Jackson et al.[18]alsolackedSODactivity.Thus,if Cu does bind elsewhere in the protein this is not relevant to the protein’s antioxidant activity. Deletion of only part of the octameric repeat region renders the protein inactive. This confirms previous suggestions that binding only one atom of Cu is not sufficient for significant SOD-like activity of the protein [17]. The importance of residues 35–45 is currently unknown. However, it might be that this region of the protein interacts with other regions of the protein, possibly to bring the Cu-binding domain into proximity with the hydrophobic domain or the C-terminal globular domain. This interpretation is supported by our earlier findings that there are interactions between the N terminus and the C terminus of PrP. Binding of a monocolonal antibody to an epitope located between residues 35 and 45 prevented the binding of another monoclonal antibody that reacts with a conformational epitope in the C terminus [52]. Analysis of the evolutionary conservation of the prion protein among mammals clearly shows that all three critical domains (residues 35–45, 51–89, 112–136) are extremely highly conserved. Indeed, the region 112–126 is identical in all mammals, birds and reptiles so far sequenced [10,53,54]. Therefore this report indicating that residues 112–136 constitute part of the functional domain of the protein provides a plausible explanation for the high evolutionary conservation of this region. Other research has shown the importance of this region in PrP neurotoxicity [55,56] as a binding site for PrP ligands [57,58]. There are already several reports that link oxidative stress to prion disease [59–63]. Also, changes in the essential metalloelements in the brains of patients with CJD and experimental mouse scrapie have also been noted [28,29]. These findings suggest that changes in Cu meta- bolism and redox balance occur in prion diseases. The exact nature of these changes is far from clear. However, there is evidence that loss of Cu binding to PrP and consequently, loss of PrP’s antioxidant activity occur early in the course of prion disease [31]. The relevance of the findings presented here are therefore quite important in determining the changes that PrP undergoes during the course of prion disease and the possible role of the loss of its function to the disease. It is known that the hydropho- bic domain spanning amino acids 112–136 form a critical site in the protein at which the protein gains b-sheet content [64]. This region also spans the site at which normal metabolic cleavage occurs [65]. Deletion of this region inhibits conversion of the protein to PrP Sc in infected cells [66]. The importance of this region to the function of the protein explains its evolutionary conserva- tion. Conversion of this site to one that forms b-sheet and facilitates aggregation of the protein is known to prevent cleavage of the protein [67] and abolish antioxidant activity [31]. Furthermore, interaction between this site on PrP c and PrP Sc or the neurotoxic peptides such as PrP106–126 also inhibits the antioxidant activity of PrP c [31] or cause the protein to change conformation [67]. In summary we have provided an insight into regions of PrP c critical to its normal antioxidant activity. We have shown that regions outside the octameric repeat region are necessary for this activity. These data suggest that a key domain in PrP c that is involved in structural conversion of the protein to PrP Sc may be conserved in evolution because of its importance to this function. Acknowledgements Thanks to Dr Laurie Irons for assistance with CD measurements. This work was supported by a fellowship from the BBSRC of the UK to DRB. 3374 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003 References 1. Prusiner, S.B. (1982) Novel proteinaceous infectious particles cause scrapie. Science 216, 136–144. 2. Prusiner, S.B. (1998) Prions. Proc.NatlAcad.Sci.USA95, 13363–13383. 3. Hope, J., Reekie, L.J., Hunter, N., Multhaup, G., Beyreuther, K., White,H.,Scott,A.C.,Stack,M.J.,Dawson,M.&Wells,G.A. (1988) Fibrils from brains of cows with new cattle disease contain scrapie-associated protein. Nature 336, 390–392. 4. Will, R.G., Ironside, J.W., Zeidler, M., Cousens, S.N., Estibeiro, K.,Alperovitch,A.,Poser,S.,Pocchiari,M.,Hofman,A.& Smith, P.G. (1996) A new variant of Creutzfeldt-Jakob disease in the UK. Lancet 347, 921–925. 5. Rubenstein, R., Merz, P.A., Kascsak, R.J., Carp, R.I., Scalici, C.L., Fama, C.L. & Wisniewski, H.M. (1987) Detection of scra- pie-associated fibrils (SAF) and SAF proteins from scrapie- affected sheep. J. Infect. Dis. 156, 36–42. 6. Hsiao, K. & Prusiner, S.B. (1990) Inherited human prion diseases. Neurology 40, 1820–1827. 7. Stahl, N., Borchelt, D.R., Hsiao, K. & Prusiner, S.B. (1987) Scrapie prion protein contains a phosphatidylinositol glycolipid. Cell 51, 229–240. 8. Meyer, R.K., McKinley, M.P., Bowman, K.A., Braunfeld, M.B., Barry, R.A. & Prusiner, S.B. (1986) Separation and properties of cellular and scrapie prion proteins. Proc.NatlAcad.Sci.USA83, 2310–2314. 9. Pan, K.M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A., Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R.J., Cohen, F.E. & Prusiner, S.B. (1993) Conversion of alpha-helices into beta- sheets features in the formation of the scrapie prion proteins. Proc. NatlAcad.Sci.USA90, 10962–10966. 10. Wopfner, F., Wiedenho ¨ fer, G., Schneider, R., von Bunn, A., Gilch,S.,Schwarz,T.F.,Werner,T.&Scha ¨ tzl, H.M. (1999) Analysis of 27 mammalian and 9 avian PrPs reveals high con- servation of flexible regions of the prion protein. J. Mol. Biol. 289, 1163–1178. 11. Bu ¨ eler,H.,Fischer,M.,Lang,Y.,Bluethmann,H.,Lipp,H P., DeArmond, S.J., Prusiner, S.B., Aguet, M. & Weissmann, C. (1992) Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature 356, 577–582. 12. Bu ¨ eler, H., Aguzzi, A., Sailer, A., Greiner, R.A., Autenried, P., Aguet, M. & Weissmann, C. (1993) Mice devoid of PrP are resistant to scrapie. Cell 73, 1339–1347. 13. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1996) Role of microglia and host prion protein in neurotoxicity of a prion pro- tein fragment. Nature 380, 345–347. 14. Brown, D.R., St. Nicholas, R., J. & Canevari, L. (2002) Lack of prion protein expression results in a neuronal phenotype sensitive to stress. J. Neurosci. Res. 67, 211–224. 15. Hornshaw,M.P.,McDermott,J.R.,Candy,J.M.&Lakey,J.H., (1995) Copper binding to the N-terminal repeat region of mammalian and avian prion protein: structural studies using synthetic peptides. Biochem. Biophys. Res. Comm. 214, 993–999. 16. Brown, D.R., Qin, K., Herms, J.W., Madlung, A., Manson, J., Strome, R., Fraser, P.E., Kruck, T., von Bohlen, A., Schulz- Schaeffer, W., Giese, A., Westaway, D. & Kretzschmar, H. (1997a) The cellular prion protein binds copper in vivo. Nature 390, 684–687. 17. Brown, D.R., Clive, C. & Haswell, S.J. (2001) Anti-oxidant activity related to copper binding of native prion protein. J. Neurochem. 76, 69–76. 18. Jackson, G.S., Murray, I., Hosszu, L.L., Gibbs, N., Waltho, J.P., Clarke, A.R. & Collinge, J. (2001) Location and properties of metal-binding sites on the human prion protein. Proc. Natl Acad. Sci. USA 98, 8531–8535. 19. Viles, J.H., Cohen, F.E., Prusiner, S.B., Goodin, D.B., Wright, P.E. & Dyson, H.J. (1999) Copper binding to the prion protein: Structural implications of four identical cooperative binding sites. Proc.NatlAcad.Sci.USA96, 2042–2047. 20. Aronoff-Spencer, E., Burns, C.S., Avdievich, N.I., Gerfen, G.J., Peisach, J., Antholine, W.E., Ball, H.L., Cohen, F.E., Prusiner, S.B. & Millhauser, G.L. (2000) Identification of the Cu 2+ binding sites in the N-terminal domain of the prion protein by EPR and CD spectroscopy. Biochemistry 39, 13760–13771. 21. Cereghetti,G.M.,Schweiger,A.,Glockshuber,R.&VanDoor- slaer, S. (2001) Electron Paramagnetic Resonance Evidence for Binding of Cu 2+ to the C-terminal Domain of the Murine Prion Protein. Biophys. J. 81, 516–525. 22. Brown, D.R. (1999) Prion protein expression aids cellular uptake and veratridine-induced release of copper. J. Neurosci. Res. 58, 717–725. 23. Pauly, P.C. & Harris, D.A. (1998) Copper stimulates endocytosis of the prion protein. J. Biol. Chem. 273, 33107–33110. 24. Ellis, V., Daniels, M., Misra, R. & Brown, D.R. (2002) Plasminogen activation is stimulated by prion protein and regulated in a copper-dependent manner. Biochemistry 41, 6891– 6896. 25. Pan,T.,Wong,B.S.,Liu,T.,Li,R.,Petersen,R.B.&Sy,M.S. (2002) Cell surface prion protein interacts with glycosamino- glycans. Biochem. J. 368, 81–90. 26. Brown, D.R., Schultz-Schaeffer, W.J., Schmidt, B. & Kretzsch- mar, H.A. (1997) Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Exp. Neurol. 146, 104–112. 27. Wong,B.S.,Pan,T.,Liu,T.,Li,R.L.,Gambetti,P.&Sy,M.S. (2000) Differential contribution of superoxide dismutase activity by prion protein in vivo. Biochem. Biophys. Res. Commun 273, 136–139. 28.Brown,D.R.,Wong,B.S.,Hafiz,F.,Clive,C.,Haswell,S.& Jones, I.M. (1999) Normal prion protein has an activity like that of superoxide dismutase. Biochem. J. 344, 1–5. 29. Brown, D.R., Iordanova, I.M., Wong, B S., Ve ´ nien-Bryan, C., Hafiz, F., Glasssmith, L.L., Sy, M S., Gambetti, P., Jones, I.M., Clive, C. & Haswell, S.J. (2000) Functional and structural differ- ences between the prion protein from two alleles prnp a and prnp b of mouse. Eur. J. Biochem. 267, 2452–2459. 30. Wong, B S., Chen, S.G., Colucci, M., Xie, Z., Pan, T., Liu, T., Li, R., Gambetti, P., Sy, M S. & Brown, D.R. (2001a) Aberrant metal binding by prion protein in human prion disease. J. Neuro- chem. 78, 1400–1408. 31. Thackray, A.M., Knight, R., Haswell, S.J., Bujdoso, R. & Brown, D.R. (2002) Metal imbalance and compromised antioxidant function are early changes in prion disease. Biochem. J. 362, 253–258. 32. Brown, D.R. (2000) PrP Sc -like prion protein peptide inhibits the function of cellular prion protein. Biochem. J. 352, 511–518. 33. Daniels, M., Cereghetti, G.M. & Brown, D.R. (2001) Toxicity of novel C-terminal prion protein fragments and peptides harbouring disease-related C-terminal mutations. Eur. J. Biochem. 268, 6155–6164. 34. Pan,T.,Li,R.,Wong,B.S.,Liu,T.,Gambetti,P.&Sy,M S. (2002) Heterogeneity of normal prion protein in two-dimensional immunoblot: presence of various glycosylated and truncated forms. J. Neurochem. 81, 1092–1101. 35. Liu,T.,Zwingman,T.,Li,R.,Pan,T.,Wong,B.S.,Petersen,R.B., Gambetti,P.,Herrup,K.&Sy,M.S.(2001)Differentialexpres- sion of cellular prion protein in mouse brain as detected with multiple anti-PrP monoclonal antibodies. Brain Res. 896, 118–129. Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3375 36. Zanusso,G.,Liu,D.,Ferrari,S.,Hegyi,I.,Yin,X.,Aguzzi,A., Hornemann, S., Liemann, S., Glockshuber, R., Manson, J.C., Brown, P., Petersen, R.B., Gambetti, P. & Sy, M.S. (1998) Prion protein expression in different species: analysis with a panel of new mAbs. Proc.NatlAcad.Sci.USA95, 8812–8816. 37. Collinge, J., Whittington, M.A., Sidle, K.C., Smith, C.J., Palmer, M.S., Clarke, A.R. & Jefferys, J.G. (1994) Prion protein is necessary for normal synaptic function. Nature 370, 295–297. 38. Tobler, I., Gaus, S.E., Deboer, T., Achermann, P., Fischer, M., Ru ¨ licke, T., Moser, M., Oesch, B., McBride, P.A. & Manson, J.C. (1996) Altered circadian activity rhythms and sleep in mice devoid of prion protein. Nature 380, 639–642. 39. Hu ¨ ber, R., Deboer, T. & Tobler, I. (2002) Sleep deprivation in prion protein deficient mice sleep deprivation in prion protein deficient mice and control mice: genotype dependent regional rebound. Neuroreport 13,1–4. 40. Curtis,J.,Errington,M.,Bliss,T.,Voss,K.&Macleod,N.(2003) Age-Dependent Loss of PTP and LTP in the hippocampus of PrP- null Mice. Neurobiol. Dis. 13, 55–62. 41. Walz, R., Amaral, O.B., Rockenbach, I.C., Roesler, R., Izquierdo, I.,Cavalheiro,E.A.,Martins,V.R.&Brentani,R.R.(1999) Increased sensitivity to seizures in mice lacking cellular prion protein. Epilepsia 40, 1679–1682. 42. White, A.R., Collins, S.J., Maher, F., Jobling, M.F., Stewart, L.R., Thyer, J.M., Beyreuther, K., Masters, C.L. & Cappai, R. (1999a) Prion protein-deficient neurons reveal lower glutathione reductase activity and increased susceptibility to hydrogen per- oxide toxicity. Am. J. Pathol. 155, 1723–1730. 43. Zeng, F., Watt, N.T., Walmsley, A.R. & Hooper, N.M. (2003) Tethering the N-terminus of the prion protein compromises the cellular response to oxidative stress. J. Neurochem. 84, 480–490. 44. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1997c) Effects of oxidative stress on prion protein expression in PC12 cells. Int. J. Dev Neurosci. 15, 961–972. 45. Brown, D.R., Hafiz, F., Glasssmith, L.L., Wong, B S., Jones, I.M., Clive, C. & Haswell, S.J. (2000) Consequences of manganese replacement of copper for prion protein function and proteinase resistance. EMBO J. 19, 1180–1186. 46. Miele, G., Jeffrey, M., Turnbull, D., Manson, J. & Clinton, M. (2002) Ablation of cellular prion protein expression affects mito- chondrial numbers and morphology. Biochem. Biophys. Res. Commun. 291, 372–377. 47. Behrens, A. & Aguzzi, A. (2002) Small is not beautiful: antag- onizing functions for the prion protein PrP c and its homologue Dpl. Trends Neurosci. 25, 150–154. 48. Sorenson, J.R. (2001) Prion diseases: copper deficiency states associated with impaired nitrogen monoxide or carbon monoxide transduction and translocation. J. Inorg. Biochem. 87, 125–127. 49. Fridovich, I. (1975) Superoxide dismutases. Ann. Rev. Biochem. 44, 146–159. 50.Riek,R.,Hornemann,S.,Wider,G.,Glockshuber,R.& Wu ¨ thrich, K. (1997) NMR characterization of the full-length recombinant murine prion protein mPrP (23–231). FEBS Lett. 413, 282–288. 51. Wong, B.S., Venien-Bryan, C., Williamson, R.A., Burton, D.R., Gambetti, P., Sy, M.S., Brown, D.R. & Jones, I.M. (2000) Copper refolding of prion protein. Biochem. Biophys. Res. Commun. 276, 1217–1224. 52. Li, R., Liu, T., Wong, B.S., Pan, T., Morillas, M., Swietnicki, W., O’Rourke,K.,Gambetti,P.,Surewicz,W.K.&Sy,M.S.(2000) Identification of an epitope in the C terminus of normal prion protein whose expression is modulated by binding events in the N terminus. J. Mol. Biol. 301, 567–573. 53. Scha ¨ tzl,H.M.,DaCosta,M.,Taylor,M.,Cohen,F.E.&Prusiner, S.B. (1995) Prion protein gene variation among primates. J. Mol. Biol. 245, 362–374. 54. Simonic, T., Duga, S., Strumbo, B., Asselta, R., Ceciliani, F. & Ronchi, S. (2000) cDNA cloning of turtle prion protein. FEBS Lett. 469, 33–38. 55. Forloni,G.,Angeretti,N.,Chiesa,R.,Monzani,E.,Salmona,M., Bugiani, O. & Tagliavini, F. (1993) Neurotoxicity of a prion protein fragment. Nature 362, 543–546. 56. Brown, D.R. (2000) Prion protein peptides: Optimal toxicity and peptide blockade of toxicity. Mol. Cell Neurosci. 15, 66–78. 57. Martins, V.R., Graner, E., Garcia-Abreu, J., de Souza, S.J., Mercadante, A.F., Veiga, S.S., Zanata, S.M., Neto, V.M. & Brentani, R.R. (1997) Complementary hydropathy identifies a cellular prion protein receptor. Nature Med. 3, 1376–1382. 58. Zanata, S.M., Lopes, M.H., Mercadante, A.F., Hajj, G.N., Chi- arini, L.B., Nomizo, R., Freitas, A.R., Cabral, A.L., Lee, K.S., Juliano, M.A., de Oliveira, E., Jachieri, S.G., Burlingame, A., Huang, L., Linden, R., Brentani, R.R. & Martins, V.R. (2002) Stress-inducible protein 1 is a cell surface ligand for cellular prion that triggers neuroprotection. EMBO J. 21, 3307–3316. 59. Kim,N.H.,Park,S.,Jin,J.,Kwon,M.,Choi,E.,Carp,R.I.& Kim, Y. (2000) Increased ferric iron content and iron-induced oxidative stress in the brains of scrapie-infected mice. Brain Res. 884, 98–103. 60. Milhavet, O., McMahon, H.E., Rachidi, W., Nishida, N., Kata- mine, S., Mange, A., Arlotto, M., Casanova, D., Riondel, J., Favier, A. & Lehmann, S. (2000) Prion infection impairs the cel- lular response to oxidative stress. Proc. Natl Acad. Sci. USA 97, 13937–13942. 61. Guentchev, M., Voigtla ¨ nder,T.,Haberler,C.,Groschup,M.H.& Budka, H. (2000) Evidence for oxidative stress in experimental prion disease. Neurobiol. Dis. 7, 270–273. 62. Guentchev, M., Siedlak, S.L., Jarius, C., Tagliavini, F., Castellani, R.J., Perry, G., Smith, M.A. & Budka, H. (2002) Oxidative damage to nucleic acids in human prion disease. Neurobiol. Dis. 9, 275–281. 63. Wong, B S., Brown, D.R., Pan, T., Whiteman, M., Liu, T., Bu, X., Li, R., Gambetti, P., Olesik, J., Rubinstein, R. & Sy, M S. (2001b) Oxidative impairment in scrapie-infected mice is asso- ciated with brain metal perturbations and altered ani-oxidantion activities. J. Neurochem. 79, 689–698. 64. Viles, J., Donne, D., Kroon, G., Prusiner, S.B., Cohen, F.E., Dyson, H.J. & Wright, P.E. (2001) Local structural plasticity of the prion protein. Analysis of NMR relaxation dynamics. Biochemistry 40, 2743–2753. 65. Chen, S.G., Teplow, D.B., Parchi, P., Teller, J.K., Gambetti, P. & Autilio-Gambetti, L. (1995) Truncated forms of the human prion proteininnormalbrainandinpriondiseases.J. Biol. Chem. 270, 19137–19180. 66. Ho ¨ lscher, C., Delius, H. & Bu ¨ rkle, A. (1998) Overexpression of non-convertable PrPcD114–121 in scrapie-infected mouse neuro- blastoma cells leads to trans-dominant inhibition of wild-type PrPSc accumulation. J. Virol. 72, 1153–1159. 67. Nguyen, J., Baldwin, M.A., CohE.N., F.E. & Prusiner, S.B. (1995) Prion protein peptide induces a-helix to b-sheet conformation transitions. Biochemistry 34, 4186–4192. 3376 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003 . series of PrP mutants were made to assess whether deletions of certain domains of the protein decrease the SOD-like activity of the protein. The domains. sensitive to the conformation of the C terminus indicated that the conformation of the C terminus is important to the activity of the protein. Deletion of the whole