The yeast ubiquitin ligase Rsp5 downregulates the alpha subunit of nascent polypeptide-associated complex Egd2 under stress conditions Hiroyuki Hiraishi 1, *, Takashi Shimada 2, *, Iwao Ohtsu 1 , Taka-Aki Sato 2 and Hiroshi Takagi 1 1 Graduate School of Biological Sciences, Nara Institute of Science and Technology, Nara, Japan 2 Life Science Research Center, Shimadzu Co., Tokyo, Japan Introduction Stress induces protein denaturation, generates abnor- mal proteins, and leads to growth inhibition or cell death. Such abnormal proteins are ubiquitinated and mainly degraded via the proteasome pathway, as indi- cated by the fact that some ubiquitin-conjugating enzyme mutants and ubiquitin ligase mutants showed increased sensitivity to various stresses [1–3]. A few studies have analysed the degradation system of stress- induced ubiquitinated proteins using model substrates, for example mis-folded proteins such as CPY*, a mutant type of carboxypeptidase Y, or ubiquitin-fused proteins such as ubiquitinated b-galactosidase [4,5]. It Keywords nascent polypeptide-associated complex; Saccharomyces cerevisiae; stress response; ubiquitination; ubiquitin ligase Rsp5 Correspondence H. Takagi, Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192, Japan Fax: +81 743 72 5429 Tel: +81 743 72 5420 E-mail: hiro@bs.naist.jp *These authors contributed equally to this work (Received 23 May 2009, revised 6 July 2009, accepted 20 July 2009) doi:10.1111/j.1742-4658.2009.07226.x The ubiquitination and subsequent degradation of stress-induced abnormal proteins are indispensable to cell survival. We previously showed that a yeast (Saccharomyces cerevisiae) mutant carrying a single amino acid change, Ala401Glu, in RSP5, which encodes an essential E3 ubiquitin ligase, is hypersensitive to various stresses. To identify the protein sub- strates of Rsp5, we performed a comparative proteome analysis of the wild-type and rsp5 mutant strains under stress conditions. The results we obtained indicate that several proteins, including the a-subunit of nascent polypeptide-associated complex (aNAC, Egd2) accumulated in the rsp5 mutant. To investigate whether or not Rsp5 ubiquitinates these proteins in a stress-dependent manner, cell extracts were analyzed by immunoprecipita- tion followed by western blotting after exposure to temperature upshift. Interestingly, Egd2 was ubiquitinated in the wild-type cells but not in the rsp5 mutant cells under these stress conditions. We also detected in vitro ubiquitination of Egd2 by Rsp5 at elevated temperature. Moreover, Egd2 was ubiquitinated in the egd1 and not4 deletion mutants lacking bNAC and the RING-type ubiquitin ligase Not4, respectively, indicating that ubiquitination of Egd2 is independent of Egd1 and Not4. We also showed that, under stress conditions, Egd2 was mainly degraded via the protea- some pathway. These results strongly suggest that Rsp5 is involved in selec- tive ubiquitination and degradation of stress-induced unstable proteins, such as Egd2. Structured digital abstract l MINT-7228949: EGD2 (uniprotkb:P38879) physically interacts (MI:0915) with ubiquitin (uniprotkb: P61864) by anti-tag co-immunoprecipitation (MI:0007) Abbreviations CX, cycloheximide; NAC, nascent polypeptide-associated complex. FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5287 has also been reported that short-lived or long-lived proteins are degraded by the proteasome or vacuolar proteolysis pathways, respectively [6], but the detailed mechanisms underlying these pathways are poorly understood. Previously, we isolated a yeast (Saccharomyces cere- visiae) mutant that is hypersensitive to various stresses, including toxic amino acid analogues, high growth temperature in a rich medium, ethanol, LiCl and H 2 O 2 . This mutant carried a single amino acid change, replacing Ala (GCA) at position 401 with Glu (GAA) in the RSP5 allele encoding an essential HECT-type E3 ubiquitin ligase [7]. Therefore, we speculate that Rsp5 is involved in degradation of stress-induced abnormal proteins and that the mutant Rsp5 fails to recognize or ubiquitinate the targeted proteins. Recently, we showed that Rsp5 primarily regulates the expression of Hsf1 and Msn2 ⁄ 4, major transcription factors that are required for expression of genes encod- ing stress proteins, at the post-transcriptional level, and is involved in the repair system for stress-induced abnormal proteins [8,9]. The Rsp5 protein is known to ubiquitinate plasma membrane permeases such as the general amino acid permease Gap1, followed by endo- cytosis and vacuolar degradation [10]. On the other hand, Rsp5 has been reported to mediate stress- induced degradation of cytosolic proteins such as Hpr1, a member of the THO ⁄ TREX (transcription ⁄ export) complex that couples mRNA transcription to nuclear export, and the large subunit of RNA poly- merase II [11,12]. These results suggest that Rsp5 is involved in the expression of some proteins at both the transcriptional and post-translational level. However, it remains unclear what kind of proteins are denatured and trigger growth inhibition or cell death under stress conditions. Hence, identification of the sub- strates of ubiquitin ligase represents a major challenge to understanding of the mechanism of ubiquitination and degradation via either the proteasome-mediated or vacuolar proteolysis pathway under stress conditions. The nascent polypeptide-associated complex (NAC) is conserved throughout the eukaryotic world from yeast to human, where it is present as a heterodimer composed of two subunits (aNAC and bNAC) that are both in direct contact with nascent polypeptide chains protruding from the ribosome to protect from protease attack [13–15]. The yeast genome encodes one aNAC (Egd2) and two bNAC (Egd1 and Btt1) [16– 18]. Both bNACs can form heterodimeric complexes with aNAC, although Btt1 is significantly less abun- dant than Egd1 [19,20]. NAC was thought to be involved in the mitochondrial import of precursor proteins by having a stimulatory effect on protein targeting in vitro [14]. Moreover, the general impor- tance of NACs is emphasized by the embryonic lethality of NAC mutants in mice, nematodes (Caenor- habditis elegans) and fruit flies (Drosophila melanoga- ster), although deletion of the genes encoding NAC results in no obvious phenotypes in yeast [21–23]. Recently, it was found that Egd2 was ubiquitinated by the RING-type E3 ubiquitin ligase Not4 when glucose was decreased in the growth medium [24]. However, it remains to be elucidated how ubiquitination of this complex could contribute to the interaction with ribo- somes or nascent polypeptides. To identify the targeted substrates for Rsp5 whose ubiquitination and subsequent degradation could play a crucial role in cell survival under severe stress condi- tions, we performed a proteome analysis of the wild- type and rsp5 mutant strains using comparative 2D-PAGE and MS. We show that the Egd2 protein is ubiquitinated by Rsp5 and degraded mainly via the proteasome pathway under stress conditions. Our results reveal that several proteins can be ubiquitinated by Rsp5 in a stress-dependent manner, and we propose a model for the role of Rsp5 under stress conditions. Results Comparative proteome analysis of the wild-type and rsp5 mutant cells under stress conditions We previously isolated the rsp5 mutant strain CHT81, which, relative to the wild-type strain, shows greater sensitivity to various stresses that induce protein dena- turation or mis-folding in the cell, such as toxic amino acid analogues, high growth temperature in a rich medium, ethanol, LiCl and H 2 O 2 [7]. Thus, we pro- posed a novel function of Rsp5 in selective degrada- tion of abnormal proteins generated by such stresses. To identify stress-dependent substrates for Rsp5, we performed a proteome analysis of strains CKY8 (wild- type) and CHT81 (rsp5 mutant) exposed to tempera- ture upshift using comparative 2D-PAGE and MS (Fig. 1 and Table 1). The activity of Rsp5 is indispens- able to regulate the expression of many proteins at the transcriptional and post-translational level, because Rsp5 is known to regulate the activity of the RNA polymerase II and Hpr1, which is a member of the THO ⁄ TREX complex [11,12]. Nevertheless, some pro- teins, such as Hsp12, Pda1, Sod1, Hsp78 and Egd2, accumulated to higher levels in the rsp5 mutant cells than in the wild-type cells under high growth tempera- ture in a rich medium (Fig. 1A and Table 1). As it is known that the heat-shock proteins (Hsp12 and Hsp78) and Sod1 are induced in response to various Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al. 5288 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS stresses, we excluded these proteins from further analy- sis as candidate substrates of Rsp5 (Fig. 1A). Thus, we focused on the behavior of other two proteins, i.e. Egd2 and Pda1 (Fig. 1B). Egd2 was upregulated in the wild-type cells within 2 h after temperature upshift, and was subsequently downregulated. However, in the rsp5 mutant cells, Egd2 was upregulated within 4 h after temperature upshift, and its level then remained stable. The protein level of Pda1 in the rsp5 mutant cells increased in a time-dependent manner compared with wild-type cells throughout the temperature upshift. Identification of substrates of Rsp5 under stress conditions Based on the above results showing that some proteins accumulated in the rsp5 mutant in a stress-dependent A B Egd2 0246 8 (h) 024 6 8 Pda1 CHT81 (rsp5 mutant) CHT81 (rsp5 mutant) CHT81 (rsp5 mutant) CKY8 (Wild-type) CKY8 (Wild-type) 024 6 8Time (h) Time (h) 02468 (h) CHT81 (rsp5 mutant) CKY8 (Wild-type) Hsp12 Egd2 Sod1 Egd2 Pda1 Pda1 Hsp78 Hsp78 Hsp12 Sod1 250 150 100 75 50 37 25 20 15 10 250 150 100 75 50 37 25 20 15 10 pH pH 5.0 8.0 pH pH 5.0 8.0 Fig. 1. Comparative proteome analysis of yeast cells. (A) Strains CKY8 (wild-type) and CHT81 (rsp5 mutant) were cultured to stationary growth phase in YPD medium at 25 °C and subjected to a temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Cell extracts were prepared from the cultures and subjected to 2D-PAGE. The gel patterns represent the cell extracts for each strain after shifting to 37 °C for 6 h. Pro- teins were visualized using Coomassie brilliant blue G-250. Proteins that accumulate in the rsp5 mutant cells are indicated by arrowheads and protein names. The positions of molecular mass standards are shown on the left. (B) Time course of the change in Egd2 and Pda1 amounts in strains CKY8 (wild-type) and CHT81 (rsp5 mutant) subjected to temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Histograms show the protein abundance based on the intensity of bands in the 2D gels indicated by white and black bars for the wild-type and rsp5 mutant strains, respectively. Table 1. Classification of identified gene products that accumulated in the rsp5 mutant strains under high growth temperature. Gene Function Peptide sequence identified HSP12 Heat shock protein ASEALKPD SQKSYAEQGK EYITDK PDA1 a-subunit of pyruvate dehydrogenase complex GFCHLSVGQEAIAVGIENAITK SOD1 Cu–Zn superoxide dismutase VQAVAVLKGD AGVSGVVK HSP78 Heat shock protein MDPNQQPEKPALEQFGTNLTK EGD2 a-subunit of nascentpolypeptide associated complex LAAAQQQAQASGIMPSNEDVATK H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5289 manner, we constructed wild-type and rsp5 mutant strains expressing HA fusion proteins such as Pda1– HA and Egd2–HA, and examined the stability of these proteins at 25 or 37 °C using the protein synthesis inhibitor cycloheximide (CX). In the absence of CX, western blot analysis using anti-HA serum showed that the protein level of Egd2 in the wild-type cells (CKE8) gradually decreased after the temperature upshift, probably due to its degradation (Fig. 2A). It is note- worthy that the level of Egd2 in the rsp5 mutant cells (CHE81) remained stable (Fig. 2A). However, in the presence of CX, the amount of Egd2 was decreased in both the wild-type and rsp5 mutant cells after the tem- perature upshift. There was no significant difference in the amounts of other proteins between the strains after up to 6 h of exposure to high temperature (data not shown). Next, we examined whether or not Egd2 is ubiquiti- nated by Rsp5 in the wild-type cells under stress condi- tions (Fig. 2B). When the wild-type and rsp5 mutant strains expressing Egd2–HA (CKE8 and CHE81, respectively) were exposed to high growth temperature, the polyubiquitin-conjugated form of Egd2 was clearly detected in the wild-type cells. However, it seems likely that little ubiquitination of Egd2 occurred in the rsp5 mutant cells (Fig. 2B). As Egd2 was shown to be ubiquitinated in the wild- type cells, but not in the rsp5 mutant cells under stress conditions, we examined whether or not Rsp5 can directly ubiquitinate Egd2 at high temperature by an in vitro ubiquitination assay using Ubc4 and Egd2–HA as the E2 enzyme and the substrate, respectively (Fig. 3). In agreement with the results of the in vivo ubiquitination experiment, more polyubiquitinated Egd2 was detected in the presence of Rsp5 at 37 °C than at 25 °C. Moreover, the monoubiquitinated form of Rsp5 was detected at both temperatures (25 and 37 °C). Taken together, our results show that Egd2 is ubiquitinated by Ubc4 and then polyubiquitinated in the presence of Rsp5 under stress conditions such as high temperature. Ubiquitination of Egd2 is independent of Egd1 and Not4 Panasenko et al. [24] recently reported that Egd2 and Egd1, which form a heterodimeric complex named A B 0124Time (h) +CX–CX –CX +CX 25 °C 37 °C CKE8 (Wild-type) CHE81 (rsp5 mutant) Egd2 Pgk1 Egd2 Pgk1 124124124 Time (h) Time (min) CKE8 (Wild-type) CHE81 (rsp5 mutant) Ub-Egd2 Egd2 Pgk1 0 30 60 120 0 30 60 120 Fig. 2. Stress-induced ubiquitination of Egd2 by Rsp5. Strains CKE8 (wild-type) and CHE81 (rsp5 mutant) expressing Egd2–HA were cultured to logarithmic growth phase at 25 °C and shifted to 37 °C for the times indicated. (A) The wild-type and rsp5 mutant cells were incubated for indicated times in the presence or absence of 0.2 mgÆml )1 CX at 25 or 37 °C. Whole-cell extracts were prepared, and the protein levels of Egd2–HA were examined by western blot analysis using an anti-HA serum. (B) The Egd2–HA proteins were immunoprecipitated from whole-cell extracts using anti-HA serum. Egd2–HA and ubiquitinated proteins were then detected by western blot analysis using anti-HA and anti-ubiquitin sera, respectively. The cytosolic Pgk1 protein used as a protein- loading control was detected using an anti-Pgk1 serum. Rsp5 Rsp5 Rsp5 Egd2 (Ub)n-Egd2 Egd2 Ubc4 25 °C 37 °C Fig. 3. In vitro ubiquitination of Egd2 by Rsp5. Purified recombinant Egd2–HA was incubated with E1, Ubc4, Ub and ATP in the pres- ence or absence of Rsp5 at 25 or 37 °C. For the negative control, Egd2–HA or Ubc4 were omitted. Egd2–HA and ubiquitinated proteins were detected as described in Fig. 2B. The recombinant His6-tagged Rsp5 proteins were detected using an anti-His serum. Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al. 5290 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS NAC, are ubiquitinated by the RING-type ubiquitin ligase Not4, particularly when glucose is decreased in the growth medium. We thus investigated whether stress-induced ubiquitination of Egd2 might depend on the presence of Egd1 and Not4 using strains CKE8e1 (egd1D) and CKE8n4 (not4D) expressing Egd2–HA at 25 or 37 °C (Fig. 4A,B). As with wild-type strain CKE8 cells, polyubiquitination of Egd2 was observed in cells of both deletion mutants at 37 °C. These results show that Rsp5-mediated ubiquitination of Egd2 is independent of Egd1 and Not4 under stress conditions. Degradation pathway of Egd2 ubiquitinated by Rsp5 To explore the pathway involved in degradation of the ubiquitinated Egd2, we first examined the protein lev- els of Egd2 by western blot analysis using mutant strains deficient in the major proteolytic pathways (the vacuolar and proteasome pathways) (Fig. S1). Under high temperature, Egd2 was clearly degraded in cell extracts of the wild-type strains (YPH500 and CKE8). A similar result was obtained using the pep4-disrupted strain CKE8p4, which lacks the major vacuolar prote- olytic pathway, under stress conditions. In contrast, Egd2 was stabilized even at elevated temperature in the cim5-1 temperature-sensitive mutant CMY765E in which proteasome activity is impaired [25]. The Cim5 protein is one of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degra- dation of ubiquitinated substrates [25]. Next, to further examine the role of the proteasome in degradation of heat-labile Egd2, we analyzed the stability of Egd2 at 25 or 37 °C using CX (Fig. 5). Under high temperature, in the presence or absence of CX, Egd2 was clearly destabilized in cell extracts of the wild-type strain (YPH500E) compared with the cim5-1 mutant deficient in the proteasome pathway (CMY765E). These results show that Egd2 is degraded mainly via the proteasome pathway under high tem- peratures. Discussion Conformational changes in proteins caused by post- translational modifications, such as oxidation [26], phosphorylation[27] and N-linked glycosylation [28], are involved in specific recognition by ubiquitin ligase for ubiquitination of the substrate proteins. These observations suggest that stress-induced unfolding or mis-folding of proteins may also be a signal for ubiqui- tination of denatured proteins that are recognized by the appropriate ubiquitin ligase. In human cells, block- ing of the metabolism of mis-folded proteins leads to the formation of intracellular aggregates, which causes serious diseases such as neurodegenerative disorders, B A Ub-Egd2 0 30 60 120 30 60 120 0 30 60 120 30 60 120 25 °C 37 °C 25 °C 37 °C Egd2 Pgk1 CKE8e1 (egd1D) CKE8 (Wild-type) Time (min) 0 30 60 120 30 60 120 0 30 60 120 30 60 120 25 °C 37 °C 25 °C 37 °C Ub-Egd2 Egd2 Pgk1 CKE8n4 (not4D) CKE8 (Wild-type) Time (min) Fig. 4. Ubiquitination of Egd2 in the absence of Egd1 and Not4. Strains CKE8 (wild-type) (A,B), CKE8e1 (egd1D) (A) and CKE8n4 (not4D) (B) expressing Egd2–HA were cultured to logarithmic growth phase at 25 °C and shifted to 37 °C for the times indicated. The ubiquitination of Egd2–HA were examined by western blot analysis as described in Fig. 2B. The cytosolic Pgk1 protein used as a protein-loading control was detected using an anti-Pgk1 serum. Egd2 Pgk1 Egd2 Pgk1 YPH500E (Wild-type) CMY765E (cim-1) 0124Time (h) 25 °C –CX –CX +CX +CX 37 °C 124 124 124 Fig. 5. Degradation of Egd2 under stress conditions. Strains YPH500E (wild-type) and CMY765E (cim5-1) expressing Egd2–HA were cultured to logarithmic growth phase at 25 °C, and incubated for indicated times in the presence or absence of 0.2 mgÆml )1 CX at 25 or 37 °C. Whole-cell extracts were prepared, and the protein levels of Egd2–HA were examined by western blot analysis using an anti-HA serum. The cytosolic Pgk1 protein used as a protein- loading control was detected using an anti-Pgk1 serum. H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5291 including Alzheimer’s disease, Huntington’s disease and amyotrophic lateral sclerosis [29,30]. These aggre- gates are ubiquitinated by RING-type ubiquitin ligases such as Parkin, following active sequestration into ag- gresomes and autophagic clearance [31]. It is also reported that U-box- and RING-type ubiquitin ligases such as CHIP, San1 and Ubr1 are involved in ubiquiti- nation of denatured proteins under stress conditions [32–34]. In addition, identification of ubiquitinated forms of mis-folded proteins by HECT-type ubiquitin ligase under stress conditions has not been studied pre- viously. Thus, we focused here on the function of HECT-type ubiquitin ligase and the degradation mech- anism of the substrates under stress conditions using yeast cells. We previously isolated the yeast HECT-type ubiqu- itin ligase rsp5 mutant, which shows hypersensitivity to various stresses that induce protein mis-folding in the cell, probably because this mutant fails to ubiquitinate the mis-folded abnormal proteins generated under stress conditions [7]. In the present study, we identified Egd2 (aNAC) as one of the protein substrates for Rsp5 under stress conditions. The Egd2 protein was co-purified with its partner Egd1 [16]. Egd2 forms a complex with Egd1 (b 1 NAC) as well as Btt1 (b 2 NAC) in vivo. Cells lacking both Egd1 and Btt1 show growth defects at 37 °C. However, such temperature sensitivity does not occur when the EGD2 gene is disrupted in the egd1D btt1D background [19]. Rospert et al. [15] interpreted this result as follows: in the absence of its partner subunits, Egd2 negatively affects the growth of yeast cells, and the induction of several genes, includ- ing the GAL genes, is due to a toxic effect of ‘mono- meric’ Egd2. Thus we speculate that, under stress conditions, unstable forms of Egd2 are not ubiquitinat- ed but accumulate in the rsp5 mutant cells, leading to growth inhibition or cell death. It should be noted that the mRNA levels of EGD2 were almost the same in wild-type and rsp5 cells, and were not significantly affected by stress (data not shown). This suggests that ubiquitin-conjugated forms of Egd2 are produced under stress conditions, but that little ubiquitination of the native forms of Egd2 occurs under non-stress con- ditions. We also found that the stability of Egd2 was decreased in wild-type cells but not in rsp5 mutant cells in the absence of CX (Fig. 2A). However, in the pres- ence of CX, Egd2 levels were decreased in both the wild-type and rsp5 mutant cells. This result suggests that newly synthesized Egd2, but not already existing Egd2, accumulates in rsp5 mutant cells. This raises the possibility that Rsp5 is involved in regulation of the Egd2 level by either direct or indirect ubiquitination, regardless of the stress. Rsp5 has been shown to play a pivotal role in the nuclear export and modification of mRNA, rRNA and tRNA [35,36]. Ubiquitination of some mRNA nuclear transport factors contributes to regulation of this transport pathway. mRNA export requires that newly synthesized precursor mRNAs undergo several pro- cessing steps, which include 5¢-capping, splicing, 3¢-end cleavage and polyadenylation. The various steps lead- ing to formation of the ribonucleoprotein complex are linked, and are often mediated by interactions with the RNA polymerase II transcription machinery. Recently, Neumann et al. [37] reported that the rsp5-3 mutant was strongly impaired in nuclear export of mRNA and ribosomal 60S subunits after a shift from 25 to 37 ° C. In addition, tRNA and rRNA export defects in the rsp5-3 mutant are preceded by severe inhibition of pre- tRNA and pre-rRNA processing. In our study, how- ever, there were no significant differences in the levels of EGD2 mRNA between the wild-type and rsp5 cells under stress conditions (data not shown). Taking this account, it appears that Rsp5 does not regulate Egd2 at the transcriptional level, but is involved in post- translational modifications such as ubiquitination. Egd2 is reportedly ubiquitinated by the Ccr4–Not complex, containing Not4 as the RING-type ubiquitin ligase, under physiological conditions such as glucose depletion [24]. In addition, Egd2 does not associate with a ubiquitin molecule, although it contains a ubiquitin-associated domain [38]. However, it is inter- esting that stress-induced ubiquitination of Egd2 is likely to occur in a Not4-independent manner. Thus we concluded that the ubiquitination mechanism of Egd2 differs between non-stress and stress conditions. Although Rsp5 has three WW domains that bind the PY motifs conserved in its substrates [39–41], no PY motif is found in the amino acid sequence of Egd2. Therefore, other motifs or sequences in the unstable Egd2 may be recognized via the WW3 domain of Rsp5 in order for ubiquitination to proceed. Panasenko et al. [24] reported ubiquitination of Egd2 but did not demonstrate the degradation path- way of ubiquitinated Egd2. Here, we found that the Egd2 protein is degraded via the proteasome pathway at elevated temperatures. This result suggests that the polyubiquitin-conjugated form of Egd2 under stress conditions is degraded through the proteasome path- way like other mutant or abnormal proteins [42]. George et al. [43] reported that yeast mutant cells lack- ing NAC suffered from mitochondrial defects and decreased levels of mitochondria co-translationally. On the other hand, purified Egd2 has been reported to prevent the aggregation of a denatured model protein, suggesting that Egd2 has a chaperone-like activity [44]. Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al. 5292 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS In addition to Rsp5-regulated ubiquitination and degradation of unstable proteins such as Egd2, the stress-induced instability of Egd2 might cause its dys- function, leading to mis-targeting and ⁄ or mis-folding of mitochondrial proteins in the cell under stress con- ditions. In addition, it is important to determine whether or not Egd2 is correctly folded and functions under stress conditions. Unfortunately, we could not obtain any direct evidence of mis-folding or denaturing of the Egd2 protein despite various functional analyses such as a pulldown assay using glutathione S-transfer- ase (GST) to detect denatured and inactive forms of Egd2 under stress conditions. It may be difficult to prove that Egd2 is inactive under stress conditions because both Egd2 (aNAC) and Egd1 (b 1 NAC) mole- cules have low molecular weights and each NAC domain in the two proteins is also small [45], so that the unfolded or mis-folded Egd2 proteins might be folded correctly in the purification or interaction pro- cess. In the wild-type strain, it is probable that the ubiquitinated forms of Egd2 are degraded as part of an adaptive response to stress rather than a conse- quence of mis-folding in the proteasome, and yeast cells could acquire stress resistance. In contrast, the Egd2 proteins in the rsp5 mutant strain might accumu- late under stress conditions, and yeast cells would show stress sensitivity. We must further analyze how Rsp5 recognizes Egd2 and which lysine residue in the ubiquitin molecule participates in the polyubiquitina- tion of Egd2 under stress conditions. The above approach could be a useful method for studying the ubiquitin-mediated degradation of stress- induced abnormal proteins. It is unclear whether or not the molecular mechanism of ubiquitin ligase Rsp5 can distinguish between native and unfolded states of the proteins under stress conditions. We aim to deter- mine whether there is a general rule underlying the mechanism to distinguish unfolded forms from native ones by using model protein substrates. Experimental procedures Materials Monoclonal anti-HA (12CA5), anti-ubiquitin (P4D1), anti- 3-phosphoglycerate kinase (22C5), and anti-pentaHis sera were purchased from Roche Diagnostics (Mannheim, Germany), Santa Cruz Biotechnology (Santa Cruz, CA, USA), Molecular Probes (Eugene, OR, USA) and Qiagen (Valencia, CA, USA), respectively. Horseradish peroxidase- coupled secondary antibody was from GE Healthcare (Piscataway, NJ, USA). N-ethylmaleimide (solubilized in DMSO) and electrophoresis reagents were purchased from Nacalai Tesque (Kyoto, Japan). Strains and plasmids The S. cerevisiae strains used in this study are listed in Table 2. Strains CKE8, CHE81, YPH500E and CMY765E were constructed by the homologous recombination method [46]. The integration cassette from plasmid pFA6a-3HA- kanMX6 (supplied by K. Kitamura, Center for Gene Science, Hiroshima University, Japan) [47] was amplified using oligonucleotide primers EGD2-F2 and EGD2-R1 (Table 3). These PCR fragments were introduced into strains CKY8 (wild-type) (supplied by C. Kaiser, Depart- ment of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA) and YPH500 (wild-type) (supplied by Yeast Genetic Resource Center, Osaka University, Japan) or CHT81 (the Ala401Glu rsp5 mutant) [7] and CMY765 (cim5-1 mutant) (supplied by Yeast Genetic Resource Center), and strains into which EGD2-3HA-Kan was integrated were selected as geneticin (G418)-resistant transformants. The correct integration and expression of EGD2 were confirmed by PCR, DNA sequencing and western blot analysis. To construct pGEX-EGD2HA, the DNA fragment of EGD2 was amplified by PCR performed using genomic DNA from CKY8 and oligonucleotide primers EGD2- EcoRI (+) and EGD2HA-XhoI ()) (Table 3). The unique amplified band of 565 bp corresponding to EGD2-HA was Table 2. Yeast strains used in this study. Strain Genotype References CKY8 MATa ura3-52 leu2-3, 112 RSP5 [7] CKE8 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan This study CKE8e1 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan egd1::URA3 This study CKE8n4 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan not4::URA3 This study CHT81 MATa ura3-52 leu2-3, 112 rsp5A401E [7] CHE81 MATa ura3-52 leu2-3, 112 rsp5A401E EGD2-3HA-Kan This study YPH500 MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 Yeast Genetic Resource Center YPH500E MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 EGD2-3HA-Kan This study CMY765 MATa cim5-1 ura3-52 leu2-D1 his3-D200 Yeast Yeast Genetic Resource Center CMY765E MATa cim5-1 ura3-52 leu2-D1 his3-D200 EGD2-3HA-Kan This study H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5293 digested with EcoRI and XhoI, and then ligated into the EcoRI and XhoI sites of pGEX-6P-1 (GE Healthcare) to construct pGEX-EGD2HA, which expresses GST-tagged Egd2–HA. We also amplified the DNA fragment containing the 2nd exon of UBC4 by PCR performed using pUBC4 containing UBC4 including its intron and oligonucleotide primers UBC4-BamHI (+) and UBC4-XhoI ()) (Table 3). The unique amplified band of 455 bp corresponding to the 2nd exon of UBC4 was digested with BamHI and XhoI and then ligated into the BamHI and XhoI sites of pBlue- script II SK+ (Toyobo Biochemicals, Osaka, Japan). The resultant plasmid was digested with BamHI to amplify the cDNA of UBC4 using oligonucleotide primers UBC4-SmaI (+) and UBC4-XhoI ()) (Table 3). The unique amplified band of 503 bp corresponding to cDNA of UBC4 was digested with SmaI and XhoI and then ligated into the SmaI and XhoI sites of pGEX-6P-1 to construct pGEX-UBC4, which expresses GST-tagged Ubc4. To prepare recombinant Rsp5, the DNA fragment containing the WW1 and HECT domains of Rsp5 was amplified by PCR performed using pAD-RSP5 [8] containing full-length RSP5 and oligonucleo- tide primers WW-Sph (+) and HECT-Pst ()) (Table 3). The unique amplified band of 1.8 kbp corresponding to the RSP5 fragment was digested with SphI and PstI and then ligated into the SphI and PstI sites of pQE2 (Qiagen) to con- struct pQE-RSP5, which expresses His6-tagged Rsp5. Escherichia coli strain JM109 (recA1 endA1 gryA96 thi-1 hsdR17 supE44 relA1 D(lac-proAB) ⁄ F’ [traD36 proAB + lacI q lacZDM15]) was used as a host for plasmid construc- tion and the expression of Egd2–HA, Ubc4 and Rsp5. Culture media The media used for growth of S. cerevisiae were a nutrient medium, YPD (2% glucose, 1% yeast extract, 2% peptone) and a synthetic minimal medium, SD (2% glucose, 0.67% Bacto yeast nitrogen base without amino acids; Difco Laboratories, Detroit, MI). Where appropriate, required supplements were added to the SD medium for auxotrophic strains. The E. coli recombinant strains were grown in Luri- a–Bertani complete medium (LB) containing 50 lgÆml )1 ampicillin or M9 minimal medium plus 2% Casamino acids (M9CA) containing 50 lgÆml )1 ampicillin. If necessary, 2% agar was added to solidify the medium. Disruption of the NOT4 and EGD1 genes Complete gene disruption of NOT4 and EGD1 were performed by gene replacement using homologous recom- bination [48] to construct strains CKE8n4 and CKE8e1, respectively. Oligonucleotides used to generate the PCR products were as follows: NOT4, NOT4disURA3 (+) and NOT4disURA3 ()); EGD1, EGD1disURA3 (+) and EGD1disURA3 ()) (Table 3). The correct gene disruptions were confirmed by PCR. Sample preparation, 2D-PAGE, and gel image analysis Strains CKY8 and CHT81 cells were grown to the stationary phase (attenuance at 600 nm of 10) in YPD medium at 25 °C and subjected to temperature upshift (to 37 °C) for 0, 2, 4, 6 and 8 h. The cells were harvested and washed, and suspended in three volumes of Y-PER-S (Pierce, Rockford, IL, USA), and the whole-cell extracts were prepared by vortexing the cells with glass beads. The protein concentration was determined by the Bradford method, and desalted by cold 10% TCA precipitation. The protein pellet (300 lg) was rinsed with cold ethanol ⁄ diethylether solution to remove TCA. Collected proteins were air-dried, and solubilized in 200 lL of isoelectric focusing buffer containing 6 m urea, 2 m thiourea, 3% Chaps, 1% Triton X-100 and 50 mm dithiothreitol. The protein solution was diluted using an IPG ReadyStrip gel (pH 5-8, 11 cm, Bio-Rad, Hercules, CA, Table 3. Oligonucleotides used in this study. The underlining indicates the sequence upstream of the initiation codon and downstream of the termination codon of each target gene. The bold letters indicate the restriction sites GAATTC (EcoRI), CTCGAG (XhoI), GGATCC (BamHI), CCCGGG (SmaI), GCATGC (SphI) and CTGCAG (PstI). Name Oligonucleotide sequence (5¢-to3¢) EGD2-F2 CAATGGTGACTTAGTCAACGCTATCATGTCCTTGTCTAAACGGATCCCCGGGTTAATTAA EGD2-R1 AGAATAACTACGTACCCCTATATAATATATTTTTATATCAGAATTCGAGCTCGTTTAAAC NOT4disURA3(+) TCGTATATAATCCAGTCATAATGATGAATCCACACGTTCAAGAAAATTTGCAAGCAATCCAATGTGGCTGTGGTTTCAGG NOT4disURA3()) CTGCAGCAAGAGATTGCTTCTTCTTGCTACCATGGGAGTGACTTGTAGCATTGGTATTGGGTTCTGGCGAGGTATTGGAT EGD1disURA3(+) GGAGGTTTAAGAATAGAACATCTCACACCAGACGCGACTCATAATTCATAATGCCAATTGAATGTGGCTGTGGTTTCAGG EGD1disURA3()) AGTTATTTATTCGACGTCAGCATCAAAAGTTTGACCTTCAACTAACTCTGGAATAGCTTCGTTCTGGCGAGGTATTGGAT EGD2-EcoRI(+) CCGGAATTCATGTCTGCTATCCCAGAAA EGD2HA-XhoI()) AATTCTCGAGTTAAGCGTAATCTGGTACGTCGTATTTAGACAAGGACATGATAGCG UBC4-BamHI(+) CACAGGATCCAGATCCACCTACTTCATGTT UBC4-XhoI()) CCGCTCGAGCGGGCTTCTCTTTTTCAGCTGAG UBC4-SmaI(+) AATACCCGGGGATGTCTTCTTCTAAACGTATTGCTAAAGAACTAAGTGATCTAGAAAGAGATCCACCTACTTCATGTT WW-Sph(+) CAATGCATGCCAGACAATACTCTTCGTTTG HECT-Pst()) GAACTGCAGAATAATCATTCTTGACCAA Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al. 5294 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS USA). Isoelectric focusing was performed at 5000 V for 16 h using an isoelectric focusing cell (Bio-Rad). After equilibrat- ing the strip gel with 2D-PAGE buffer containing 6 m urea, 2% SDS, 2% dithiothreitol, 20% glycerol and bromophenol blue, 2D-PAGE was performed on an 10-18% gradient gel and stained using 0.1% Coomassie brilliant blue G-250 solution. Gel images were acquired by using a GS-800 calibrated imaging densitometer (Bio-Rad), and protein spot quantification was performed using PDQuest software (Bio-Rad). Individual protein spot intensity was normalized against the total intensity of detected spots. Protein identification by MS Protein spots were listed by quantitative variation of time- dependent fashion. Selected spots were excised, and reduc- tive alkylation was performed using 10 mm dithiothreitol and 100 mm ammonium bicarbonate at 56 °C, followed by 55 mm iodoacetatamide and 100 mm ammonium bicarbon- ate at room temperature in the dark. After washing off residual reagent and dehydrating from gel slice, the protein was digested using trypsin in 50 mm ammonium bicarbon- ate and 5 mm calcium chloride at 37 °C for 15 h. Peptide fragments of the tryptic digest were purified using a ZipTip microC18 (Millipore, Billerica, MA, USA), and eluted directly onto a MALDI target plate according to the manufacturer’s protocol. After air-drying, saturated a-cyano-4-hydroxycinnamic acid solution was spotted on a sample well, and MALDI-TOF MS analysis was performed using AXIMA CFRplus (Shimadzu, Tokyo, Japan). Detected peptide peaks were first externally calibrated using the bradykinin fragment ([M+H]+ 757.40) and ACTH fragment ([M+H]+ 2465.20), and internally calibrated using the trypsin autolysis fragment ([M+H]+ 842.51 and 2211.10). Protein identification was performed by peptide mass fingerprinting analysis, and monoisotopic peak pro- cessing and database searches were performed using Mascot Distiller and Mascot Protein Identification System (Matrix Science, Boston, MA, USA). Cycloheximide (CX) chase analysis Yeast cells were grown to an attenuance at 600 nm of 2.0 in YPD medium at 25 °C. After adding CX (Wako Pure Chem- icals, Osaka, Japan) to a final concentration of 0.2 mgÆ ml )1 , cells were subjected to temperature upshift (to 37 °C) for 1, 2 and 4 h. The cells were harvested and washed, and suspended in three volumes of Y-PER-S (Pierce), and whole-cell extracts were prepared as described above. SDS–PAGE and western blotting Cell lysates or immunoprecipitated proteins were subjected to SDS–PAGE using a 12.5% acrylamide gel, and trans- ferred to poly(vinylidene difluoride) membrane for protein immunoblotting [9]. Blots were visualized by enhanced chemiluminescence and autoradiography (GE Healthcare). The 3-phosphoglycerate kinase Pgk1 was used as an inter- nal control. Immunoprecipitation At the indicated times, yeast cells were recovered and washed, then suspended in Y-PER-S (Pierce) containing yeast protease inhibitor cocktail, 5 mm dithiothreitol and 5mm N-ethylmaleimide. Whole-cell extracts were pre- pared by vortexing the cells with glass beads, and diluted using ice-cold NaCl ⁄ P i . The immunoprecipitation assay was performed according to the manufacturer’s protocol (Sigma-Aldrich, St Louis, MO, USA). Diluted whole-cell extracts (40 lg of protein) were incubated with anti-HA agarose (Sigma) at 4 °C overnight. The immunoprecipitated samples were recovered after centrifugation (12 000 g, 30 s, 4 °C), and washed four times for 5 min with NaCl ⁄ P i . Immunoprecipitated proteins were eluted from agarose by incubation in 2· SDS sample buffer for 3 min at 95–100 °C. The eluted proteins were subjected to SDS– PAGE and analyzed by immunoblotting as described above. Protein purification E. coli strain JM109 expressing GST-fused Egd2–HA or His6-tagged Rsp5 was grown in M9CA medium at 37 ° C to an attenuance at 600 nm of 0.5. Protein expression was induced overnight at 18 °C using 0.1 mm isopropyl-b-d-thi- ogalactopyranoside. The GST–Ubc4 fusion protein was expressed in JM109 grown in LB medium at 37 °Ctoan attenuance at 600 nm of 0.5, and induced with 0.5 mm iso- propyl-b-d-thiogalactopyranoside for 4 h at 25 °C. Fusion proteins were purified on glutathione–Sepharose 4B beads (Amersham Biosciences, Piscataway, NJ, USA) and nickel– agarose beads (Qiagen) according to the manufacturers’ instructions. GST was cleaved from Ubc4 and Egd2–HA using pre-scission protease (Amersham Biosciences) over- night at 4 °Cin50mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl, 1mm dithiothreitol, 1 mm EDTA. In vitro ubiquitination assay Standard ubiquitination reactions contained 10 lLof 10· assay buffer (250 mm Tris ⁄ HCl, pH 7.5, 500 mm NaCl, 100 mm MgCl 2 ,30mm ATP, 1 mm dithiothreitol), 2.5 lg of ubiquitin, 0.1 lg of E1, 0.1 lg of Ubc4 E2 and 1.3 lgof Egd2–HA, with or without 0.6 lg of His6-tagged Rsp5 (E3). Reactions were allowed to proceed for 2 h at 25 or 37 °C, and stopped by addition of 4· SDS–PAGE sample buffer. The ubiquitinated Egd2–HA, His6-tagged Rsp5 and H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5295 non-ubiquitinated Egd2–HA were detected using anti- ubiquitin, anti-pentaHis and anti-HA sera, respectively. Acknowledgements We wish to thank Drs Y. Haitani, N. Yoshida, S. Morigasaki, Y. Hamano and M. Takahashi of our lab- oratory for discussions on this work. We also thank Drs K. Kitamura (Center for Gene Science, Hiroshima University, Japan), C. Kaiser (Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, USA) and the Yeast Genetic Resource Center (Osaka University, Japan) for providing plasmid and yeast strains. This work was supported by a grant to H.T. from the Program for Promotion of Basic Research Activities for Innovative Biosciences (PRO- BRAIN). References 1 Jungmann J, Reins HA, Schobert C & Jentsch S (1993) Resistance to cadmium mediated by ubiquitin-depen- dent proteolysis. Nature 361, 369–371. 2 Seufert W & Jentsch S (1990) Ubiquitin-conjugating enzymes UBC4 and UBC5 mediate selective degrada- tion of short-lived and abnormal proteins. EMBO J 9, 543–550. 3 Fisk HA & Yaffe MP (1999) A role for ubiquitination in mitochondrial inheritance in Saccharomyces cerevisi- ae. J Cell Biol 145, 1199–1208. 4 Kohlmann S, Scha ¨ fer A & Wolf DH (2008) Ubiquitin ligase Hul5 is required for fragment-specific substrate degradation in endoplasmic reticulum-associated degra- dation. J Biol Chem 283, 16374–16383. 5 Tu D, Li W, Ye Y & Brunger AT (2007) Structure and function of the yeast U-box-containing ubiquitin ligase Ufd2p. Proc Natl Acad Sci USA 104, 15599–15606. 6 Lee DH & Goldberg AL (1996) Selective inhibitors of the proteasome-dependent and vacuolar pathways of protein degradation in Saccharomyces cerevisiae. J Biol Chem 271, 27280–27284. 7 Hoshikawa C, Shichiri M, Nakamori S & Takagi H (2003) A nonconserved Ala401 in the yeast Rsp5 ubiqu- itin ligase is involved in degradation of Gap1 permease and stress-induced abnormal proteins. Proc Natl Acad Sci USA 100, 11505–11510. 8 Haitani Y, Shimoi H & Takagi H (2006) Rsp5 regulates expression of stress proteins via post-translational modi- fication of Hsf1 and Msn4 in Saccharomyces cerevisiae. FEBS Lett 580, 3433–3438. 9 Haitani Y & Takagi H (2008) Rsp5 is required for the nuclear export of mRNA of HSF1 and MSN2 ⁄ 4 under stress conditions in Saccharomyces cerevisiae . Genes Cells 13, 105–116. 10 Springael JY & Andre ´ B (1998) Nitrogen-regulated ubiquitination of the Gap1 permease of Saccharomyces cerevisiae. Mol Biol Cell 9, 1253–1263. 11 Gwizdek C, Hobeika M, Kus B, Ossareh-Nazari B, Dargemont C & Rodriguez MS (2005) The mRNA nuclear export factor Hpr1 is regulated by Rsp5-medi- ated ubiquitylation. J Biol Chem 280, 13401–13405. 12 Huibregtse JM, Yang JC & Beaudenon SL (1997) The large subunit of RNA polymerase II is a substrate of the Rsp5 ubiquitin–protein ligase. Proc Natl Acad Sci USA 94, 3656–3661. 13 Wiedmann B, Sakai H, Davis TA & Wiedmann M (1994) A protein complex required for signal-sequence- specific sorting and translocation. Nature 370, 434–440. 14 Fu ¨ nfschilling U & Rospert S (1999) Nascent polypep- tide-associated complex stimulates protein import into yeast mitochondria. Mol Biol Cell 10, 3289–3299. 15 Rospert S, Dubaquie ´ Y & Gautschi M (2002) Nascent- polypeptide-associated complex. Cell Mol Life Sci 59, 1632–1639. 16 Shi X, Parthun MR & Jaehning JA (1995) The yeast EGD2 gene encodes a homologue of the aNAC subunit of the human nascent-polypeptide-associated complex. Gene 165, 199–202. 17 Parthun MR, Mangus DA & Jaehning JA (1992) The EGD1 product, a yeast homolog of human BTF3, may be involved in GAL4 DNA binding. Mol Cell Biol 12, 5683–5689. 18 Hu GZ & Ronne H (1994) Yeast BTF3 protein is encoded by duplicated genes and inhibits the expression of some genes in vivo. Nucleic Acids Res 22, 2740–2743. 19 Reimann B, Bradsher J, Franke J, Hartmann E, Wiedmann M, Prehn S & Wiedmann B (1999) Initial characterization of the nascent polypeptide-associated complex in yeast. Yeast 15 , 397–407. 20 George R, Beddoe T, Landl K & Lithgow T (1998) The yeast nascent polypeptide-associated complex initiates protein targeting to mitochondria in vivo. Proc Natl Acad Sci USA 95, 2296–2301. 21 Bloss TA, Witze ES & Rothman JH (2003) Suppression of CED-3-independent apoptosis by mitochondrial bNAC in Caenorhabditis elegans. Nature 424, 1066– 1071. 22 Deng JM & Behringer RR (1995) An insertional muta- tion in the BTF3 transcription factor gene leads to an early postimplantation lethality in mice. Transgenic Res 4, 264–269. 23 Markesich DC, Gajewski KM, Nazimiec ME & Beck- ingham K (2000) bicaudal encodes the Drosophila beta NAC homolog, a component of the ribosomal transla- tional machinery. Development 127, 559–572. 24 Panasenko O, Landrieux E, Feuermann M, Finka A, Paquet N & Collart MA (2006) The yeast Ccr4–Not complex controls ubiquitination of the nascent-associ- Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al. 5296 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... substrates by the PY motif-insertion method for monitoring 26S proteasome activity Methods Enzymol 399, 215–227 42 Biederer T, Volkwein C & Sommer T (1996) Degradation of subunits of the Sec61p complex, an integral component of the ER membrane, by the ubiquitin proteasome pathway EMBO J 15, 2069–2076 43 George R, Walsh P, Beddoe T & Lithgow T (2002) The nascent polypeptide-associated complex (NAC)... (2008) Degradation of misfolded protein in the cytoplasm is mediated by the ubiquitin ligase Ubr1 FEBS Lett 582, 4143–4146 Rodriguez MS, Gwizdek C, Haguenauer-Tsapis R & Dargemont C (2003) The HECT ubiquitin ligase Rsp5p is required for proper nuclear export of mRNA in Saccharomyces cerevisiae Traffic 4, 566–575 Kwapisz M, Cholbinski P, Hopper AK, Rousset JP & Zoladek T (2005) Rsp5 ubiquitin ligase modulates... 714 Ubiquitination of Egd2 by Rsp5 under stress conditions 39 Hoppe T, Matuschewski K, Rape M, Schlenker S, Ulrich HD & Jentsch S (2000) Activation of a membrane-bound transcription factor by regulated ubiquitin ⁄ proteasome-dependent processing Cell 102, 577–586 40 Sudol M & Hunter T (2000) NeW wrinkles for an old domain Cell 103, 1001–1004 41 Saeki Y, Isono E & Toh-e A (2005) Preparation of ubiquitinated... disruptions in Saccharomyces cerevisiae Yeast 10, 1793–1808 Supporting information The following supplementary material is available: Fig S1 Stability of Egd2 under stress conditions This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed... translation accuracy in yeast Saccharomyces cerevisiae RNA 11, 1710–1718 Neumann S, Petfalski E, Brugger B, Grosshans H, ¨ Wieland F, Tollervey D & Hurt E (2003) Formation and nuclear export of tRNA, rRNA and mRNA is regulated by the ubiquitin ligase Rsp5p EMBO Rep 4, 1156–1162 Raasi S, Varadan R, Fushman D & Pickart CM (2005) Diverse polyubiquitin interaction properties of ubiquitin- associated domains... interaction of ribosomes with the mitochondrial surface in vivo FEBS Lett 516, 213–216 44 Grallath S, Schwarz JP, Bottcher UM, Bracher A, Hartl ¨ FU & Siegers K (2006) L25 functions as a conserved ribosomal docking site shared by nascent chain-associated complex and signal-recognition particle EMBO Rep 7, 78–84 45 Panasenko CC, David FP & Collart MA (2009) Ribosome association and stability of the nascent polypeptide-associated. .. polypeptide-associated complex is dependent upon its own ubiquitination Genetics 181, 447–460 46 Petracek ME & Longtine MS (2002) PCR-based engineering of yeast genome Methods Enzymol 350, 445–469 47 Howson R, Huh WK, Ghaemmaghami S, Falvo JV, Bower K, Belle A, Dephoure N, Wykoff DD, Weissman JS & O’Shea EK (2005) Construction, verification and experimental use of two epitope-tagged collections of budding yeast strains... that regulate HIF by prolyl hydroxylation Cell 107, 43–54 Glickman MH & Ciechanover A (2002) The ubiquitin proteasome proteolytic pathway: destruction for the sake of construction Physiol Rev 82, 373–428 Yoshida Y, Tokunaga F, Chiba T, Iwai K, Tanaka K & Tai T (2003) Fbs2 is a new member of the E3 ubiquitin ligase family that recognizes sugar chains J Biol Chem 278, 43877–43884 McClellan AJ, Tam S,... Parkin-mediated K63linked polyubiquitination: a signal for targeting misfolded proteins to the aggresome–autophagy pathway Autophagy 4, 85–87 Cyr DM, Hohfeld J & Patterson C (2002) Protein ¨ quality control: U-box-containing E3 ubiquitin ligases join the fold Trends Biochem Sci 27, 368–375 Gardner RG, Nelson ZW & Gottschling DE (2005) Degradation-mediated protein quality control in the nucleus Cell 120, 803–815... peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5297 . The yeast ubiquitin ligase Rsp5 downregulates the alpha subunit of nascent polypeptide-associated complex Egd2 under stress conditions Hiroyuki. Collart MA (2006) The yeast Ccr4–Not complex controls ubiquitination of the nascent- associ- Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi