The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes Stan Stasinopoulos 1 , Mythily Mariasegaram 1 , Chris Gafforini 1 , Yoshikuni Nagamine 2 and Robert L. Medcalf 1 1 Monash University, Australian Centre for Blood Diseases, Melbourne, Victoria, Australia 2 Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland Introduction The generation of the serine protease plasmin by the plasminogen activator system is a critical event in a variety of physiological processes, including fibrino- lysis, development, wound healing and cell migration [1–4]. Plasmin generation is regulated by two plasmin- ogen activators: urokinase-type plasminogen activator in the extracellular environment and tissue-type plas- minogen activator in the circulation. The proteolytic activities of both tissue-type plasminogen activator and urokinase-type plasminogen activator are controlled by plasminogen activator inhibitor types 1 and 2 (PAI-1 and PAI-2, respectively). One of the enigmatic features of PAI-2 is that, although it can inhibit extracellular and receptor-bound urokinase-type plasminogen Keywords 3¢ untranslated region; adenylate and uridylate-rich element; mRNA decay; plasminogen activator inhibitor type 2 Correspondence R. Medcalf, Australian Centre for Blood Diseases, Monash University, 6th Floor Burnet Building, AMREP, 89 Commercial Road, Melbourne 3004, Australia Fax: +61 3 9903 0228 Tel: +61 3 9903 0133 E-mail: robert.medcalf@med.monash.edu.au (Received 21 August 2009, revised 23 December 2009, accepted 28 December 2009) doi:10.1111/j.1742-4658.2010.07563.x Plasminogen activator inhibitor type 2 (PAI-2; SERPINB2) is a highly- regulated gene that is subject to both transcriptional and post-transcrip- tional control. For the latter case, inherent PAI-2 mRNA instability was previously shown to require a nonameric adenylate-uridylate element in the 3¢ UTR. However, mutation of this site was only partially effective at restoring complete mRNA stabilization. In the present study, we have identified additional regulatory motifs within the 3¢ UTR that cooperate with the nonameric adenylate-uridylate element to promote mRNA destabi- lization. These elements are located within a 74 nucleotide U-rich stretch (58%) of the 3¢ UTR that flanks the nonameric motif; deletion or substitu- tion of this entire region results in complete mRNA stabilization. These new elements are conserved between species and optimize the destabilizing capacity with the nonameric element to ensure complete mRNA instability in a manner analogous to some class I and II adenylate-uridylate elements present in transcripts encoding oncogenes and cytokines. Hence, post-tran- scriptional regulation of the PAI-2 mRNA transcript involves an interaction between closely spaced adenylate-uridylate elements in a manner analogous to the post-transcriptional regulation of oncogenes and cytokines. Abbreviations ARE, adenylate and uridylate rich element; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GM-CSF, granulocyte macrophage- colony-stimulating factor; IL, interleukin; PAI-2, plasminogen activator inhibitor type 2; REMSA, RNA electrophoretic mobility shift assays; RPA, RNase protection analysis. FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS 1331 activator [5,6], it exists primarily as a nonglycosylated intracellular protein. Over the past decade, evidence has accumulated to suggest a role for PAI-2 in intra- cellular events associated with apoptosis [7–11], prolif- eration and differentiation [4,12], and the innate immune response [7,13–15]. PAI-2 has also generated a substantial level of interest because of its impressive regulatory profile. It is one of the most responsive genes known (i.e. it can be induced over 1000-fold), and is regulated in a cell type-dependent manner by phorbol esters [16,17], the phosphatase inhibitor, oka- daic acid [18], tumour necrosis factor a [19,20], lipo- polysaccharide [21,22] and elevated levels of serum lipoprotein (a) [23]. Although there is a significant transcriptional component to the regulation of PAI-2 expression by these agents, in recent years, the role of post-transcriptional regulation has come to the fore because a number of studies have shown that the half- life of PAI-2 mRNA can also be altered in a treatment and cell type-dependent manner [19,22,24–26]. Post-transcriptional control of gene expression is particularly important for controlling the levels of tran- siently induced transcripts. Many of these transcripts have extremely short half-lives, and this is usually attrib- uted to the presence of adenylate and uridylate-rich instability elements (AREs) located with the 3¢ UTR [27]. Instability regions in the 3¢ UTR can comprise single- or multiple-ARE elements that either interact with each other or act independently to define the fate of a transcript in response to a specific physiological state [28–33]. AREs are usually 50–100 nucleotides in length and contain single or multiple copies of the consensus motif AUUUA, UUAUUUA(U ⁄ A)(U⁄ A) or UUAUUUAUU embedded within a U-rich sequence [34,35]. AREs have been classed into three groups (groups I, II and III), depending on their particular AU-rich sequence content [35]. Functional studies have indicated that AREs initially accelerate mRNA deadenylation, which is then followed by the degradation of the mRNA body [28,36,37]. A number of in vitro studies have also reported that both AREs and ARE-binding proteins can interact with the exosome, which then degrades the body of the transcript with 3¢-to5¢ polarity [38–40]. Recent in vivo studies, however, have elucidated a mammalian 5¢-to3¢ ARE decay pathway that is localized to P-bodies via an ARE interaction with tristetraprolin and BRF1 [41–44]. However, both 5¢-to3¢ and 3¢-to5¢ pathways can be simultaneously engaged in mRNA decay in an ARE- mediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be flexible. Recently, an excellent database compiling ARE containing transcripts was established [46] and it has been predicted that approximately 8% of human genes code for transcript that contain AREs [47]. In a previous study, we defined the functional destabi- lizing ARE element in the 3¢ UTR PAI-2 as a single nonameric AU-rich sequence (UUAUUUAUU) located 304 nucleotides upstream of the poly(A) tail [24,48] and suggested that tristetraprolin was a candidate PAI-2- nonameric element binding protein involved in desta- bilizing the PAI-2 mRNA transcript [49]. However, subsequent work from our group demonstrated that mutagenesis of the nonameric element only partially sta- bilized the b-globin-PAI-2 3¢ UTR transcript [48], sug- gesting the presence of additional functional destabilizing regions within the PAI-2 3¢ UTR. In the present study, we reveal that the nonameric ARE resides within a 108 nucleotide U-rich (54%) region consisting of three pentameric AU elements (one of which is a no- nameric motif) and one atypical AU-rich region, and that this extended region fully accounts for the complete destabilizing activity of the PAI-2 3¢ UTR. Further- more, functional mapping within the 108 AU-rich region revealed that the essential destabilizing sequences, con- sisting of the first two pentameric motifs and the atypical AU-rich region, resided within a continuous 74 nucleo- tide region, which we now define as the functional PAI-2 mRNA ARE element. The nonameric motif indeed com- prises the core sequence that is essential for constitutive mRNA decay; however, its optimal destabilizing activity is only achieved in a cooperative manner with either one of two auxiliary AREs. The results obtained support the concept that AU-rich instability elements can be composed of multiple AREs that act in a synergistic manner to destabilize or stabilize transcripts depending on the physiological status of the cell. Finally, our studies show that PAI-2 mRNA harbours a spatial and functional class I ARE profile that is more analogous to that of highly-regulated cytokines and oncogenes, including granulocyte macrophage-colony-stimulating factor (GM-CSF), interleukin (IL)-8 and c-fos. This may explain why the regulation of the PAI-2 gene differs so vastly from the broader family of serine proteases. Results Mutation of the PAI-2 3¢ UTR nonameric sequence results in only partial mRNA stabilization To re-assess the mRNA destabilizing characteristics of the PAI-2 3¢ UTR, we established a tetracycline- regulated system to accurately determine mRNA decay rates. Accordingly, we used a HT-1080 fibrosarcoma PAI-2 mRNA decay requires a multicomponent ARE S. Stasinopoulos et al. 1332 FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS TET-OFF system (Clontech, Mountain View, CA, USA) in combination with a plasmid pTETBBB (referred to as pTETGLO), which contains the gene for b-globin under the control of a tetracycline-regulated promoter that allows transcription only in the absence of tetracycline or a derivative (e.g. doxycycline) [50]. We cloned the full- length wild-type PAI-2 3¢ UTR, and a mutant PAI-2 3¢ UTR containing a four nucleotide substitution within the nonameric ARE (UUAUUUAUU to UUA AAG CUU) sequence into the unique BglII site in the b-globin 3¢ UTR of plasmid pTETGLO to create plasmids pTET GLO PAI)2 and pTETGLO ARE II-MUT , respectively. These plasmids, including the empty vector, pTETGLO, were transiently transfected into HT-1080 fibrosarcoma TET-OFF cells and the decay characteristics (t 1 ⁄ 2 min) of the various transcripts were determined after the addi- tion of doxycycline by RNase protection analysis (RPA). As shown in Fig. 1, the half-life of the wild-type b-globin transcript was greater than 480 min, beyond the end point of the experiment (based on the composite curve of three separate experiments presented in Fig. 1), demon- strating the high stability of this transcript. The half-life of the b-globin PAI)2 transcript was reduced to 158 min, whereas the half-life of the b-globin ARE II-MUT transcript only increased to 301 min (Fig. 1). This demonstrates that mutation of this element only partially stabilized the b-globin ARE II-MUT transcript, which is in agreement with previous studies from our laboratory using a differ- ent mRNA decay system [48] and also supports the hypothesis that the PAI-2 3¢ UTR contains uncharacter- ized functional instability elements. The PAI-2 3¢ UTR mRNA destabilizing elements are localized to a 108 nucleotide U-rich (54%) sequence Analysis of the PAI-2 3¢ UTR sequence (Fig. 2) revealed that the nonameric element resided within a 108 nucleotide U-rich (54%) sequence and was flanked at the 5¢ and 3¢ ends by two classical pentameric ARE (AUUUA) motifs and an atypical AU-rich region (AUUUUAUAUAAU) immediately abutting 3¢ to the nonamer. This 108 nucleotide ‘extended ARE’ can, by structure and sequence homology, be categorized as a class I ARE element [35]. Furthermore, these classical pentameric elements could be the source of the addi- tional destabilizing sequences within the ‘extended ARE’ (Fig. 2), which could act independently or in a cooperative manner with the nonameric ARE. To determine whether the ‘extended ARE’ possessed all of the destabilizing elements within the PAI-2 3¢ UTR, the entire 108 nucleotide sequence was deleted from the 3¢ UTR to create plasmid pTET- GLO 3¢ UTRDARE . This plasmid was transiently trans- fected into HT1080 TET-OFF cells and the half-life of the b-globin ARED transcript was shown to be > 480 min (Fig. 3). Hence, this deletion resulted in significant mRNA stabilization, with mRNA decay kinetics reminiscent of the wild-type b-globin transcript (Fig. 1). In addition, replacement of the 108 nucleotide ‘extended ARE’ with an equivalent length of an irrele- vant sequence also substantially stabilized the tran- script (data not shown) to an extent similar to that seen previously with the b-globin and the b-globin ARED transcripts. Moreover, cloning the 108 nucleotide ‘extended ARE’ into the BglII site in the b-globin 3¢ UTR, creating plasmid pTETGLO EXT.ARE , resulted A B C Fig. 1. The PAI-2 3¢ UTR localized nonameric sequence only par- tially contributes to PAI-2 mRNA instability. (A) Rabbit-b-globin-PAI- 23¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. (B) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A). After 16 h of incubation, doxycycline was added and total RNA was isolated at the indicated times and analysed by RPA. The graph in (C) corresponds to the experiments shown in (B) (n = 3–6). Each point represents the mean ± SE. S. Stasinopoulos et al. PAI-2 mRNA decay requires a multicomponent ARE FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS 1333 in decay characteristics similar to the b-globin PAI)2 wild-type transcript (t 1 ⁄ 2 178 min and t 1 ⁄ 2 198 min, respectively) (Fig. 4). Collectively, these experiments demonstrate that the 108 nucleotide ‘extended ARE’ contains all the essential destabilizing elements in the PAI-2 3¢ UTR. ARE I and III are not independent functional destabilizing elements To assess the relative contribution of these additional ARE elements, the essential residues in ARE I and III were mutated either alone or in combination to create plasmids pTETGLO ARE I-MUT , pTETGLO ARE III-MUT and pTETGLO ARE I+III-MUT (Fig. 2) within the context of the full-length PAI-2 3¢ UTR, and the influence of these mutations on the mRNA decay characteristics was determined. As shown in Fig. 5, the estimated half-lives of these transcripts were 231 min for the b-globin PAI)2 wild-type transcript, 204 min f or the b-globin ARE I-MUT , 193 min for the b-globin ARE III-MUT and 224 min for the b-globin ARE I+III-MUT . These experiments dem- onstrate that ARE I and III, both of which are composed of classical pentameric sequence AUUUA, do not independently contribute to the instability of the PAI-2 transcript. ARE I acts as a functional auxiliary element to the core destabilizing ARE II site To assess the possibility that the destabilizing activity exhibited by the ‘extended ARE’ was the result of A B C Fig. 2. The PAI-2 3¢ UTR contains a 108 nucleotide functional ‘extended ARE’. A diagrammatic representation of the PAI-2 3¢ UTR showing the location and sequence of the AU-rich regions of interest within the ‘extended ARE’, and the sequences of the various ‘extended ARE’ mutants that were generated. Fig. 3. Deletion of the ‘extended’ ARE from the PAI-2 3¢ UTR results in a stabilization reminiscent to the wild-type b-globin tran- script. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. Plasmids pTET- GLO PAI)2 , containing the full-length PAI-2 3¢ UTR, and pTET- GLO 3¢ UTRDARE in which the ‘extended ARE’ is deleted. (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantified by RPA as described in Fig. 1 and the Experimental procedures. The experiments shown in (C) were repeated three times and each point represents the mean ± SE. PAI-2 mRNA decay requires a multicomponent ARE S. Stasinopoulos et al. 1334 FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS cooperation between the classical AU-rich elements, double-ARE mutants (ARE II and ARE I; or ARE II and ARE III) were created within the context of the full-length PAI-2 3¢ UTR to create constructs pTETGLO ARE I+II-MUT and pTETGLO ARE II+III-MUT and their decay characteristics were determined. The b-globin ARE I+II-MUT transcript was significantly stabilized (t 1 ⁄ 2 > 480 min; Fig. 6), to a level reminis- cent to that seen for the b-globin (Figs 1 and 4) and b-globin ARED (Fig. 3) transcripts, compared to the wild-type b-globin PAI)2 ( 192 min) transcript in this series of experiments (Fig. 6). This result suggests that ARE I is an essential functional auxiliary element to the core destabilizing ARE II sequence and that this combination of AU-rich elements (ARE I⁄ ARE II) plays a central role in determining the half-life of the PAI-2 mRNA transcript under physiological conditions. Curiously, the half-life of the b-globin ARE II+III double mutant transcript was only partially stabilized to 347 min (Fig. 6), which is also reminiscent of the half-life of 333 min for the b-globin ARE II-MUT transcript (Fig. 1). This implies that ARE III is unlikely to cooperate with the AREII ⁄ nonameric element to contribute to the destabilizing activity of the ‘extended ARE’ in the presence of an active ARE I. A B C Fig. 4. The 108 nucleotide ‘extended ARE’ independently confers mRNA instability in an analogous manner to the PAI-2 full-length 3¢ UTR. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. Plasmids pTET- GLO, Plasmids pTETGLO PAI)2 , containing the full-length PAI-2 3¢ UTR, and pTETGLO EXT.ARE containing the 108 nucleotide ‘extended ARE’. (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantified as described in Fig. 1 and according the northern hybridization protocol (see Experimental procedures). The experiments shown in (C) were repeated three times and each point represents the mean ± SE. The dotted line represents 50% mRNA remaining. A B Fig. 5. The PAI-2 ‘extended ARE’ contains two classical pentamer- ic sequences (AUUUA), designated as ARE I and III, that do not independently function as instability elements. (A) Rabbit-b-globin- PAI-2 3¢ UTR constructs prepared for the transient transfections of HT1080-TET OFF cells. The full-length PAI-2 3¢ UTR was cloned into the 3¢ UTR of b-globin creating plasmid pTETGLO PAI)2 . A five nucleotide substitution (as shown in Fig. 2) was introduced into the ARE I and the ARE III pentameric sequences, individually or in com- bination, to create pTETGLO ARE I-MUT , pTETGLO ARE III-MUT and pTETGLO ARE I+III-MUT . (B) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quantified by RPA as described in Fig. 1 and the Experimental procedures. The experi- ments shown in (B) were repeated two or three times and each point represents the mean ± SE. S. Stasinopoulos et al. PAI-2 mRNA decay requires a multicomponent ARE FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS 1335 The ‘extended ARE’ contains an alternate atypical AU-rich auxiliary element that interacts with the core ARE II sequence Comparison of the human PAI-2 3¢ UTR with those from a number of mammalian species (Fig. 7) using clustalw [50a] analyses revealed a high degree of conservation between the ARE II (nonameric) sequences and a 12 nucleotide atypical AU-rich sequence (labelled ARE IV) immediately 3¢ to ARE II. To determine the extent to which this sequence contributed to the decay rate, the same seven nucleo- tide substitution (gUUAUUUAUUau gcauuccuau) was introduced into the abutting atypical ARE IV site within the context of the full-length 3¢ UTR (Fig. 2) to create the plasmid pTETGLO ARE IV-MUT .As determined by our TET-regulated globin mRNA decay system, disruption of this element resulted in a half-life of the b-globin ARE IV-MUT transcript of  223 min (Fig. 8) compared to the half-life of the b-globin PAI)2 wild-type transcript ( 182 min), which is unlikely to be a significant difference. Hence, ARE IV is unlikely to function as an independent PAI-2 mRNA destabi- lizing element. To determine whether the adjacent elements (ARE II and IV) could destabilize the transcript in an additive or cooperative manner in an analogous way to the AREI⁄ AREII region, both the ARE II and the abutting ARE IV sequence were mutated (gUUA AAGCUUaugcauuccuau) within the context of the full-length 3¢ UTR to create the plasmid pTET- GLO ARE II+IV-MUT . This plasmid was transiently transfected into HT1080 TET-OFF cells and the half- life of the b-globin ARE II+IV-MUT transcript was sub- stantially increased (t 1 ⁄ 2 > 480 min) (Fig. 8), which is equivalent to the high level of stability of the b-globin, the b-globin ARED and the b-globin ARE I+II-MUT tran- scripts (Figs 1, 3 and 6, respectively). RNA electrophoretic mobility shift assays (REMSA) were next performed to determine whether these adja- cent ARE sites played a role in protein binding activ- ity. Initial experiments confirmed that the extended wild-type ARE sequence provided specific protein binding sites for cytoplasmic proteins extracted from HT1080 TET-OFF cells (Fig. S1A). Subsequent analy- ses further indicate that mutations introduced into ARE II substantially reduced protein binding activity, which is consistent with our previous results using shorter RNA probes [48]. However, mutations intro- duced into the adjacent ARE IV had only a minimal effect on binding activity. When both the ARE II and IV sites were mutated simultaneously, binding activity was reduced to the level seen with mutations in ARE II alone (Fig. S1B). Hence, ARE IV does not appear to modulate protein binding activity to the ‘extended ARE’, despite the fact that it contributes to mRNA stability. Whether this is a consequence of the limita- tion of the REMSA approach or the influence of alternative functional AREs (e.g. ARE I) remains unknown. Taken together, the results obtained in the present study suggest that the functional PAI-2 3¢ UTR insta- bility sequence consists of an essential core nonameric sequence, for which the optimal destabilizing activity A B C Fig. 6. The ARE I pentameric sequence can optimize the mRNA destabilizing activity of the ARE II nonameric sequence. (A) Rabbit- b-globin-PAI-2 3¢UTR constructs prepared for the transient transfec- tion of HT1080-TET OFF cells. Double ARE mutants were con- structed by combining ARE I-MUT and ARE II-MUT to create plasmid pTETGLO ARE I+II-MUT and by combining ARE II and ARE III to create plasmid pTETGLO ARE II+III-MUT (Fig. 2). (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin repor- ter plasmids described in (A) and the b-globin mRNA decay curves were quantified by RPA as described in Fig. 1 and the Experimental procedures. The graph in (C) corresponds to the experiments shown in (B) (n = 3–5). Each point represents the mean ± SE. PAI-2 mRNA decay requires a multicomponent ARE S. Stasinopoulos et al. 1336 FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS depends on the cooperative activity of two auxiliary elements. One is a pentameric motif (ARE I) located 55 nucleotides upstream of the core ARE II element, and the second is an atypical AU-rich sequence (ARE IV) abutting 3¢ to the core ARE II sequence (Fig. 7). This functional multidomain ARE structure has been observed in a variety of class I and II ARE elements, including those of c-fos, GM-CSF, IL-8 [28,29,33]. Discussion PAI-2 is a serine protease inhibitor and is a highly-reg- ulated member of the plasminogen activator system, and is one of the most highly inducible genes known. Its expression can be dramatically increased in response to cytokines, growth factors, hormones, lipopolysaccharides and tumour promoters [16,18,20,21,51]. Although the impressive induction of PAI-2 has been attributed to transcriptional events, work from the early to mid-1990s demonstrated that PAI-2 gene expression could be regulated post-trans- criptionally via the modulation of mRNA stability [19,24]. We previously demonstrated that human PAI-2 mRNA was inherently unstable, with a half-life of  1 h and that most of the destabilizing activity was attributed to the 3¢ UTR [24] and, to a lesser extent, an instability element within exon 4 of the coding region [52]. It was originally predicted the nonameric ARE (UUAUUUAUU) located 304 nucleotides upstream of the poly(A) tail was largely responsible for the 3 ¢ UTR driven-instability of the PAI-2 tran- script. However, mutagenesis of this nonameric ARE only partially stabilized both a HGH-PAI2-3¢ UTR chimeric transcript [48] and a b-globin-PAI-2 3¢ UTR chimeric transcript (present study). Work from other groups has demonstrated that the presence of a single nonameric element [UUAUUUA(U ⁄ A)(U ⁄ A)] within a 3¢ UTR has a modest effect on the stability of a repor- ter transcript [34,53]; as such, we predicted that the PAI-2 3¢ UTR contained additional functional instabil- ity elements, AU-rich or otherwise [37,54,55], that could contribute to the overall decay rate of the tran- script. Our analysis of the PAI-2 mRNA 3¢ UTR sequence revealed that the nonameric element was present in the centre of a 108 nucleotide class I type of ARE element consisting of three copies of the AUUUA motif that were evenly distributed within a U-rich (54%) region and an atypical ARE (AREIV) immedi- ately adjacent to the nonameric element. Moreover, this region did not contain three to six clustered AUUUA motifs, which is indicative of class II ARE elements [35,56]. On the basis of this sequence analy- sis, we hypothesized that this 108 nucleotide AU-rich sequence contained all the essential destabilizing ele- ments in the PAI-2 3¢ UTR, and we confirmed this by demonstrating that either deleting the 108 nucleo- tide ARE (Fig. 3) or replacing it with an irrelevant sequence of equivalent length (data not shown) stabi- lized the transcript to a level equivalent to that seen for the wild-type b-globin transcript. Furthermore, we also demonstrated that the 108 nucleotide ARE was sufficient to destabilize the b-globin transcript with kinetics similar to those seen with the PAI-2 full-length 3¢ UTR. The pentameric motif (AUUUA) is the minimal active destabilizing sequence element when present within an appropriate AU-rich or U-rich environment. We therefore tested the hypothesis that each of these pentameric AREs (ARE I, II and III) contributed equally to the overall transcript instability and, as such, were functionally equivalent in an analogous manner to the three pentameric motifs located in the c-fos transcript [33]. However, this set of experiments (Fig. 5) demonstrated that ARE I and III did not con- tribute to transcript instability, either individually or in combination (Fig. 5). We then sought an alternative model to explain the destabilizing characteristics of the PAI-2 ‘extended ARE’ element. Fig. 7. CLUSTALW analyses of the PAI-2 ‘extended ARE’ from different mammalian species reveals a high degree conservation in the ARE II and ARE IV regions; human (accession no. J02685), Pan troglodytes (accession no. XM_001148307), mouse (accession no. X16490), and rat (accession no. X64563). The open boxes indicate the relative positions of the human ARE I, II, III and IV elements. S. Stasinopoulos et al. PAI-2 mRNA decay requires a multicomponent ARE FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS 1337 We next investigated the possibility that the struc- ture of the PAI-2 ‘extended ARE’ was based on a multidomain model consisting of an essential, func- tional destabilizing core domain (e.g. the ARE II nonameric sequence), for which the destabilizing activ- ity was optimized by the presence of nearby auxiliary AU-rich sequences. Figures 6 and 8 demonstrate that the b-globin-PAI-2 3¢ UTR chimeric transcript was only stabilized in an manner comparable to the b-glo- bin and the b-globin DARE transcripts, upon the intro- duction of two different sets of double mutations (e.g. ARE II + ARE IV mutant and ARE II + ARE I mutant). Taking into consideration the fact that muta- genesis of either ARE I or ARE IV in isolation (Figs 5 and 8, respectively) did not influence the transcript’s decay rate, we propose that the ARE II nonameric sequence forms the core destabilizing domain of the PAI-2 ARE and that its optimal destabilizing activity requires the contribution of either the 3¢ abutting ARE IV (AUUUUAUAUAAU) sequence or the 5¢ ARE I pentameric motif. Apart from optimizing the destabi- lizing activity of the core ARE II sequence, the ARE IV and ARE I elements also appear to buffer effects of mutations in the core ARE II nonameric sequence, thereby retaining the AREs destabilizing activity, albeit less efficiently (Fig. 1). Subsequently, we suggest that the PAI-2 ARE IV and ARE I elements can act as auxiliary elements to the PAI-2 core ARE II sequence. To investigate the means by which these ARE elements cooperate in modulating PAI-2 mRNA stability, REMSA analyses were performed to determine the role of the ARE II and ARE IV sites in the binding of proteins to the ‘extended ARE’. Binding of cytoplas- mic proteins to the ‘extended ARE’ probe was first shown to be specific as determined by competition titration experiments. ARE II was shown to play a sig- nificant role in this binding activity because a four nucleotide substitution introduced into the ARE II caused substantial decrease in binding activity. By con- trast, mutagenesis of ARE IV had no noticeable effect on the binding of proteins to the ‘extended ARE’ and had no additional suppression of protein binding activ- ity in the presence of the mutated ARE II. Hence, ARE IV does not appear to modulate protein binding activity to the ‘extended ARE’. The means by which ARE IV cooperates with ARE II to destabilize mRNA still remains unknown. The role of the ARE 1 site was not investigated in the present study and will be the subject of future research. Functional multidomain ARE structures have been observed in a variety of class I and II ARE elements, including those of c-fos, GM-CSF and IL-8, amongst others (Fig. 9) [28,29,33], and appear to function via similar mechanisms. Of greatest relevance to the PAI-2 ARE is the c-fos multidomain class I ARE, for which the structure and function has been characterized in detail; this ARE is composed of two structurally dis- tinct but functionally interdependent domains [33] (Fig. 9). The c-fos ARE core sequence consists of three pentameric motifs embedded within a U-rich region and is independently capable of destabilizing a tran- script. The c-fos ARE auxiliary domain II is a 20 nucleotide U-rich sequence that cannot indepen- A B C Fig. 8. An atypical AU-rich sequence (ARE IV) abutting 3¢ to the ARE II pentameric sequence can optimize the mRNA destabilizing activity of the ARE II nonameric sequence. (A) Rabbit-b-globin-PAI-2 3¢ UTR constructs prepared for the transient transfection of HT1080-TET OFF cells. The AU-rich sequence (ARE IV) abutting 3¢ to the ARE II pentameric motif was mutated to create plasmid pTETGLO ARE IV-MUT ; a double ARE mutant that combined ARE II-MUT and ARE IV was constructed to create plasmid pTETGLO ARE II+IV-MUT (Fig. 2). (B, C) HT1080-TET OFF cells were transfected with the TET-responsive b-globin reporter plasmids described in (A) and the b-globin mRNA decay curves were quanti- fied by RPA as described in Fig. 1. The experiments shown in (C) were repeated three times and each point represents the mean ± SE. PAI-2 mRNA decay requires a multicomponent ARE S. Stasinopoulos et al. 1338 FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS dently destabilize the transcript; however, when pres- ent in the appropriate context (i.e. immediately up- or downstream of the core domain I) [33], it can stimulate the deadenylation rate and thereby increase the decay rate of the transcript. Moreover, domain II of c-fos also serves the essential function of buffering the effects of mutations occurring within domain I [33]. The relative location of a functional auxiliary domain, with respect to the core domain is flexible because auxiliary domains have been identified either 5¢ or 3¢ to the core domains in class I and II AREs [28,29,33] (Fig. 9); moreover, placing the c-fos auxil- iary domain either 5¢ or 3¢ to the core domain resulted in a similar deadenylation and overall mRNA decay rate [33]. The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig. 7, the atypical AU-rich ARE IV; Fig. 8) immediately 3¢ to the core, the ARE I (AUUUA) element located 5¢ to the core element (Figs 7 and 9) also behaves as a functional auxiliary domain in the presence of a mutated ARE IV (Fig. 8). Whether the two PAI-2 auxiliary domains are simultaneously active cannot be determined from the data obtained in the present study, although it does remain a plausible hypothesis. However, we suggest that, under normal physiological conditions, the destabilizing activity of the core domain is prefer- entially optimized by auxiliary domain I (Fig. 7, the atypical AU-rich ARE IV; Fig. 9) based on the high degree of homology in the equivalent sequences of other species (Fig. 7). Moreover, the addition of the second auxiliary sequence, domain I (Fig. 9), can sup- port the destabilizing activity of the core domain in the absence of domain IV (Fig. 8). In summary, under normal physiological conditions, the PAI-2 mRNA transcript is unstable, which we now attribute to the presence of a multidomain AU-rich element within the 3 ¢ UTR (Fig. 9). ARE-mediated PAI-2 mRNA instability significantly contributes to the low constitutive levels of PAI-2 protein; however, the ARE can also modulate PAI-2 mRNA stability during physiological conditions that require high levels of PAI-2 gene expression and, subsequently, the contri- bution of post-transcriptional regulation to PAI-2 gene expression cannot be underestimated. The present study has focused on the characterization and fine mapping of the functional destabilizing AU-rich region within the PAI-2 3¢ UTR under physiological condi- tions that result in an unstable PAI-2 mRNA tran- script. We have shown that the PAI-2 ARE is a 74 nucleotide multidomain (Fig. 9) class I element con- sisting of a destabilizing core nonameric element with activity that is supported by one of two auxiliary ele- ments. Hence, in an attempt to severely inhibit constit- utive PAI-2 gene expression, nature has evolved a functional, mutation insensitive, multidomain ARE element. We are currently determining the contribution and mechanism of this ARE, and the individual ARE domains, to PAI-2 mRNA stabilization and, subse- quently, PAI-2 gene expression. Experimental procedures Plasmids and mutant construction The vector pTETBBB was provided by A. B. Shyu (Univer- sity of Texas Medical School, Houston, TX, USA). This plasmid contains the gene for b-globin under the control of a tetracycline-regulated promoter that allows the transcrip- tion of this gene in the absence of tetracycline within an appropriate mammalian cell line (e.g. HT1080-TET OFF). pTETBBB is referred to as pTETGLO throughout the present study. The PAI-2 3¢ UTR was amplified from plasmids pCMV- glo-PAI-2 3¢ UTR and pCMV-glo-PAI-2 3¢ UTR-ARE MUT [48] with primers SJS133 and SJS134, and cloned into the BglII site in the b-globin 3¢ UTR in pTETGLO, to gener- ate pTETGLO PAI)2 and pTETGLO ARE II-MUT , respectively. Fig. 9. Multidomain structure of PAI-2 (accession no. J02685), c-fos (accession no. NM_005252), GM-CSF (accession no. M11220) and IL-8 (accession no. Y00787) AREs. Sequences of the AREs are shown with the AUUUAs underlined, and the relative positions of the core and auxiliary domains are overlined. S. Stasinopoulos et al. PAI-2 mRNA decay requires a multicomponent ARE FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS 1339 Mutant variants of the PAI-2 3¢ UTR were generated via overlap extension PCR mutagenesis [57] using SJS133 and SJS134 as the external primers and the constructs pTET- GLO PAI)2 and pTETGLO ARE II-MUT as the templates. Mutation of the ARE I-AUUUA and ARE III-AUUUA sequences used primers SJS172 and SJS173, and SJS174 and SJS175, respectively. Mutation of the atypical AU-rich sequence used primers SJS259 and SJS260, and the creation of the ARE II ⁄ ARE IV double mutant used primers SJS261 and SJS262. The mutagenesis of ARE I and III introduced HindIII restriction sites and so the creation of the pTET- GLO 3¢ UTRDARE involved digesting construct pTET- GLO ARE I+III-MUT mutant with HindIII to remove the 108 bp ARE, gel purifying the larger fragment and self-liga- tion. The PAI-2 ‘extended ARE’ was amplified from plasmid pTETGLO PAI)2 using primers SJS137 and SJS138, and cloned into the BglII site in the b-globin 3¢ UTR in pTET- GLO, to generate pTETGLO EXT.ARE . The sequences of the primers used in the present study are listed in Table 1. Cell culture and transfection HT1080-TET OFF cells (Clontech) were maintained in DMEM supplemented with 10% fetal bovine serum and 100 lgÆmL )1 G418 (Life Technologies, Inc. Carlsbad, CA, USA). Cells were maintained at 37 °C in the presence of 5% CO 2 . Transient transfections were performed via the Fugene (Roche, Basel, Switzerland) method according to the manufacturer’s instructions. A typical mRNA decay experiment involved seeding five 35 mm plates with 5.0 · 10 5 cells and incubating overnight. The next day, each plate was transfected with a total of 1 lg of plasmid DNA and incubated at 37 °C for 5 h. These cells were then washed once with NaCl ⁄ P i , trypsinized, combined and equally seeded into five 35 mm to ensure equal transfection efficiency within samples and the plates were returned to the incubator for further incubation. In vitro transcription and RNase protection assay and northern hybridization A cDNA library prepared with 1 lg of total RNA extracted from an HT1080 TET-off cell line transiently transfected with pTETBBB was used to generate the rabbit b-globin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) riboprobes. Accordingly, a 295 bp b-globin frag- ment that spans the first intron was amplified using primers SJS167 and SJS170 and a 155 bp GAPDH fragment was amplified using primers ALS030 and SJS209; these frag- ments were then cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) generating pTEasy-Globin and pTEasy-GAPDH. For in vitro transcription, 500 ng of SpeI linearized pTEasy-Globin and SacII linearized pTEasy-GAPDH were incubated for 1 h in the presence of 50 lCi [a- 32 P]UTP (PerkinElmer Life and Analytical Sci- ences, Inc., Waltham, MA, USA), 10 lm UTP, 0.5 mm ATP, 0.5 mm CTP, 0.5 mm GTP, 40 U of RNase Inhibitor (Promega Corporation, Madison, WI, USA) and either Table 1. PCR and overlap PCR mutagenesis primers. The name, nucleotide sequence, orientation and GenBank nucleotide reference (where available) are provided. The introduced mutations are underlined,the restriction enzyme sites are italicized, and lower case indicates the T7 promoter sequence. PAI-2 cDNA (accession no. M18082), GADPH cDNA (accession no. M33197), pTETBBB plasmid sequence from Profes- sor A. B. Shyu (University of Texas Medical School, Houston, TX, USA). nt, nucleotide. Primer Nucleotide sequence (5¢-to3¢) Orientation SJS133 CGGA AGATCT AACTAAGCGTGCTGCTTC Forward (nt 1281–1298 PAI-2) SJS134 TACG AGATCT GTTGTTTGGAAGCAGGTT Reverse (nt 1860–1843 PAI-2) SJS137 CGGA AGATCT GGGATCATGCCCATTTAG Forward (nt 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AGCTTGGGCATGATCCC Reverse (nt 1520–1491 PAI-2) SJS174 GCTCACTGCCTA AGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2) SJS175 CTTTATTAGCTACA AAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2) SJS259 CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG Reverse (nt 1585–1552 PAI-2) SJS167 CCTCTTACACTTGCTTTTGAC Forward (nt 455–474 pTETBBB) SJS170 GCAAAGGTGCCTTTGAGGTTG Reverse (nt 897–878 pTETBBB) ALS030 GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH) SJS209 CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH) SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2) SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG T7Forward (nt 1491–1508 PAI-2) PAI-2 mRNA decay requires a multicomponent ARE S. Stasinopoulos et al. 1340 FEBS Journal 277 (2010) 1331–1344 ª 2010 The Authors Journal compilation ª 2010 FEBS [...]... and total RNA was harvested in Trizol at the indicated times Total RNA (7.5 lg) from each sample was analysed by RNase protection assay or by northern analysis (10 lg of total RNA) using the intron spanning 32P-labelled globin and GAPDH probes described above The b-globin and GAPDH mRNA band intensities were visualized and quantified with a Phosphorimager Storm (Molecular Dynamics) For each sample, the. .. functional nonameric AU-rich motif in the 3¢- untranslated region J Biol Chem 27 1, 26 074 26 080 Niiya K, Taniguchi T, Shinbo M, Ishikawa T, Tazawa S, Hayakawa Y & Sakuragawa N (1994) Different regulation of plasminogen activator inhibitor 2 gene expression by phorbol ester and cAMP in human myeloid leukemia cell line PL -21 Thromb Haemost 72, 92 97 Antalis TM & Dickinson JL (19 92) Control of plasminogen- activator. .. Nucleic Acids Res 34, D111–D114 47 Khabar KS (20 05) The AU-rich transcriptome: more than interferons and cytokines, and its role in disease J Interferon Cytokine Res 25 , 1–10 48 Maurer F, Tierney M & Medcalf RL (1999) An AU-rich sequence in the 3¢- UTR of plasminogen activator inhibitor type 2 (PAI -2) mRNA promotes PAI -2 mRNA decay and provides a binding site for nuclear HuR Nucleic Acids Res 27 , 1664–1673... glycosylated and nonglycosylated plasminogen activator inhibitor 2 in high excess over urokinase-type plasminogen activator in human U-937 lymphoma cells J Cell Biol 104, 705–7 12 Medcalf RL (19 92) Cell- and gene-specific interactions between signal transduction pathways revealed by okadaic acid Studies on the plasminogen activating system J Biol Chem 26 7, 122 20– 122 26 Pytel BA, Peppel K & Baglioni C (1990) Plasminogen. .. complexes were visualized by autoradiography References 1 Hibino T, Matsuda Y, Takahashi T & Goetinck PF (1999) Suppression of keratinocyte proliferation by plasminogen activator inhibitor- 2 J Invest Dermatol 1 12, 85–90 2 Jensen PJ, Wu Q, Janowitz P, Ando Y & Schechter NM (1995) Plasminogen activator inhibitor type 2: an intracellular keratinocyte differentiation product that is incorporated into the cornified... Plasminogen activator inhibitor type -2 is a major protein induced in human fibroblasts and SK-MEL-109 melanoma cells by tumor necrosis factor J Cell Physiol 144, 416– 422 Medcalf RL, Kruithof EK & Schleuning WD (1988) Plasminogen activator inhibitor 1 and 2 are tumor necrosis factor ⁄ cachectin-responsive genes J Exp Med 168, 751–759 Suzuki T, Hashimoto S, Toyoda N, Nagai S, Yamazaki N, Dong HY, Sakai... 12 Lian X & Yang T (20 04) Plasminogen activator inhibitor 2: expression and role in differentiation of epidermal keratinocyte Biol Cell 96, 109–116 13 Haile WB, Coleman JL & Benach JL (20 06) Reciprocal upregulation of urokinase plasminogen activator and its inhibitor, PAI -2, by Borrelia burgdorferi affects bacterial penetration and host -in ammatory response Cell Microbiol 8, 1349–1360 14 Varro A, Noble... Dickinson JL, Bates EJ, Ferrante A & Antalis TM (1995) Plasminogen activator inhibitor type 2 inhibits tumor necrosis factor alpha-induced apoptosis Evidence for an alternate biological function J Biol Chem 27 0, 27 894 27 904 11 Kumar S & Baglioni C (1991) Protection from tumor necrosis factor-mediated cytolysis by overexpression of plasminogen activator inhibitor type -2 J Biol Chem 26 6, 20 960 20 964 12. .. transferred to a Hybond-N nylon membrane (GE Healthcare, Piscataway, NJ, USA) RNA blots were stained with methylene blue to confirm for equal loading and transfer Hybridization was performed by the Rapid-Hyb hybridization protocol (GE Healthcare) using random primed [a- 32P]dATP-labelled cDNA probes corresponding to rabbit b-globin and human GAPDH isolated from plasmids pTEasy-Globin and pTEasy-GAPDH Hybridization... signals were visualized and quantified with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA) Tet-off b-globin mRNA decay assay HT1080-TET OFF cells were transiently transfected with the pTETGLO and various pTETGLO-PAI -2 3¢ UTR plasmids and seeded into 35 mm plates as described above After 16 h of incubation, doxycycline was added to stop transcription from the tetracycline responsive promoter and . The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element. element in an analogous manner to cytokines and oncogenes Stan Stasinopoulos 1 , Mythily Mariasegaram 1 , Chris Gafforini 1 , Yoshikuni Nagamine 2 and Robert L.