Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... Mechanical Engineering at UFRJ. He is a member of the Brazilian Society of Mechanical Sciences an d Engineering (ABCM) and of the American Institute of Aeronautics and Astronautics (AIAA). E-mail ... with a pointful appraisal of the mathematical optimization and exergoeconomic improvement of energy systems modeled in a professional thermodynamic process simulator. First, for mathematical optimization, ... Energy & Environment Foundation. All rights reserved. Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods...
- 14
- 593
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT ... GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCRZffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCRZffoxp3-R2 CTGCTTTTCTGGGGACTTCA Initial ... vertebrates.Significant homology was seen in the putative T-boxDNA-binding domain of t-bet, the STAT protein inter-action domain, STAT protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6,...
- 20
- 689
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... detected in controlplacenta, whole human skin, normal epidermal and immor-talized keratinocytes, dermal fibroblasts, squamous cellcarcinoma and five human melanomas. Thus, these dataclarify in detail ... plate w ithchloroform/methanol (1 : 1, v/v ), and the associatedradioactivity measured by scintillation counting.Side-chain cleavage of 7-DHC by placental and adrenalmitochondria. Incubations ... theagarose gel and purified using a GFX PCR DNA and gelband purification kit (Amersham-Pharmacia-Biotech).PCR fragments were cloned i n pGEM-T easy vector system (Promega) and purified with a plasmid...
- 11
- 475
- 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination of glucosamine and chondroitin (G+C) in the treatment of OA ... significant changes in serum chemistry (creatinine, blood urea nitrogen, alanine aminotransferase, and aspartate aminotransferase) were noted. Following UC-II withdrawal for a period of 30 days, all ... subjects at day 30 and day 60 (visits 3 and 4) for the determination of ALT, AST, bilirubin, and albumin if the subjects had been taking acetaminophen greater than 2 g/day for more than 7 days. All...
- 10
- 706
- 0
Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system
... Department of Civil Engineering, Indian Institute of Technology – Madras, Chennai 36, India. 2 Department of Ocean Engineering, Indian Institute of Technology – Madras, Chennai-36, India. Abstract ... migration significantly since they are smaller than the intergranular pores and fractures in rock and have the capacity to travel long distances in percolating waters [19]. Many researchers have ... degree at Indian Institute of Technology, Madras. His research interest include: Numerical modeling of contaminant transport in a coupled fracture matrix system. E-mail address: itsrajan2002@yahoo.co.in...
- 14
- 476
- 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... cardiac fibrosis in a paracrine manner under ischaemic conditions.Taken together, these findings may improve understanding of the cellu-lar and molecular basis of the anti -in ammatory and paracrine ... ChinaIntroductionIschaemic heart disease is a life-threatening conditionthat may cause sudden cardiac failure and death.Many researchers have investigated cell transplantationas an alternative treatment ... CA & Mahadevan LC (2001)Combinations of ERK and p38 MAPK inhibitorsablate tumour necrosis factor-alpha (TNF-alpha)mRNA induction. Evidence for selective destabilization of TNF-alpha transcripts....
- 11
- 653
- 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse)75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5¢UTR forward)85¢-ACTCGTAGC-ACAGAGACAGAG-3¢ PsCBL ... AAR01663) and AtCBL3(AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre-sents the modified amino acids alanine (A) as ... G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse)35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3...
- 19
- 706
- 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf
... parsing, semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the system at ... Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System Lewis M. Norton, Deborah A. Dahl, Li Li, and Katharine P. Beals Unisys Corporation 2476...
- 5
- 416
- 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... 1.MATERIALS AND METHODS Materials and animalsDeuterated anandamide, PalEtn and 2-AG were synthe-sized from [2H4]palmitic acid and [2H8]arachidonic acid and ethanolamine or glycerol as ... 20-foldhigher than those of anandamide. In fact, after LPS-inducedmaturation, the amounts of 2-AG were increased 2.8-fold,as in the mouse macrophage J774 cell line [24] and in ratcirculating macrophages ... rat brain and rat spleen. (A) Rat brain (lane 1) and dendritic cell (lane 2) lysates reacted with CB1antibody exhibittwo immunoreactive bands at 83 kDa and 64 kDa. Theimmunostaining of...
- 8
- 645
- 0
Từ khóa: natural mould and soil of a gardenbchj and bchm interact in a 1 1 ratio with the magnesium chelatase bchh subunit of rhodobacter capsulatussupport the design and development of an information systemstatistics in a nutshell a desktop quick reference in a nutshell oreillyadvantages and disadvantages of the english system of measurementNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ