0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Regulation of sla2p by activity in endocytosis and actin organization by the ark1 prk1 family of kinases

Regulation of sla2p by activity in endocytosis and actin organization by the ark1 prk1 family of kinases

Regulation of sla2p by activity in endocytosis and actin organization by the ark1 prk1 family of kinases

... phosphorylation by Prk1p and possibly Ark1p kinase These kinases constitute a unique family of actin regulating kinase whose substrates include many components of actin machinery as well as endocytic and ... depolymerization Actin bundling proteins such as Sac6p and Abp140p can be found coating the actin cables, and bind actin filaments together to form a cable The exact mechanism and the regulation of their ... structures: actin patches at cell cortex, actin cables running along the long axis of the cell, and the acto-myosin ring at the bud neck (Moseley and Goode, 2006) Since then, the interest in yeast...
  • 180
  • 364
  • 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... both a novel C-terminal actin- binding submodule (CABS) containing a novel actin monomer binding verprolin homology C-terminal (VH2-C) domain and a second submodule comprising the previously characterized ... actinbinding domain (this actin- binding domain has not yet been mapped) [23] We name the actin- binding domain that we have identified VH2-C and VH2-N because it is not yet clear how closely these domains ... Type I myosins can interact via an acidic tail (A) domain with the Arp2 ⁄ complex like Las17p, but they lack an actin- monomer-binding WH2 domain, which in WASP-family proteins (including Las17p) ...
  • 23
  • 679
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 772
  • 0
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

... hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase- 2) requires Ca2+ for fibronectin and heparin binding Binding properties of recombinant gelatinase A C domain to ... autocatalytic step of the activation by binding to the 64 kDa intermediate form of MMP-2 [52] Binding and activation of MMP-2 was abrogated in the presence of avb3 integrin-binding macromolecules ... (2005) Dissecting the role of matrix metalloproteinases (MMP) and integrin alpha(v)beta3 in angiogenesis in vitro: absence of hemopexin C domain bioactivity, but membrane-Type 1-MMP and alpha(v)beta3...
  • 18
  • 463
  • 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... BA & Maki M (20 03) Analysis of epidermaltype transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol Sci 32 , 95–1 03 ... Baxa U & Steinert P (20 03) Roles of calcium ions in the activation and activity of the transglutaminase enzyme J Biol Chem 278, 238 34– 238 41 30 Hitomi K, Presland RB, Nakayama T, Fleckman P, Dale ... specific for TGase in principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence...
  • 11
  • 645
  • 0
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

... AT activity in both cortex and medulla of human kidneys and show that cortical and medullary lyso-PAF AT share similar biochemical properties indicating common cellular sources Materials and ... system of creatinine phosphate and creatinine phosphate kinase exerted the same inhibitory effect on both standard PAF and the lipid product of similar aggregatory activity Mild alkaline hydrolysis ... effective than BSA in binding PAF or lyso-PAF [31] In our assays, it seems that the microsomal proteins can bind PAF effectively preventing it from inhibiting lyso-PAF AT activity and the addition...
  • 9
  • 324
  • 0
Paper Manufacture in Central and Eastern Europe Before the Introduction of Paper-making Machines pptx

Paper Manufacture in Central and Eastern Europe Before the Introduction of Paper-making Machines pptx

... introducing into the technique of making paper by hand in Europe and characteristics of European hand-made papers The genuinely European art of making paper by hand developed in Fabriano and ... middle of the 19th century in eastern parts of Europe, where paper- making machines were slowly introduced into paper industry Some main alterations in paper technology introduced after initiating European ... papermakers, who contributed much to the development of making paper by hand in central and eastern parts of Europe, introduced to their new home-lands also their terminology of papermaking and...
  • 109
  • 576
  • 0
research report  'using the activity in pairs and in groups to teach writing in english'

research report 'using the activity in pairs and in groups to teach writing in english'

... given and the procedure is repeated - When the work has finished, the students open them and, in writing, join the fragments of information together to make it more interesting and logical - The ... - Ask the students to get into pairs Give out copies of one text to half of the class and the other text to the half - Ask them to list all the words in their text alphabetically - Ask the students ... adapt to games as long as their purpose in the writing lesson is clear and they not overshadow what the 90 students feel objectives to be their main III SOME WRITING GAMES EMPLOYED IN THE WRITING...
  • 4
  • 470
  • 1
Báo cáo y học:

Báo cáo y học: "Expression of cytokine mRNA and protein in joints and lymphoid organs during the course of rat antigen-induced arthritis" potx

... preparation In an independent AIA study, samples of knee-joint SM, inguinal LNs, and spleen were obtained from rats killed at six time points: day 0, hours, day 1, day 3, and day of AIA Cytokine protein ... antigen-induced arthritis the course of AIA (Table 1, in conjunction with Fig and Table 3, underlining the predominantly local character of AIA Cytokine mRNA and protein expression in the synovial ... (days) cytokine mRNA Time course of knee-joint swelling in rats with AIA used to evaluate cytokine mRNA Values are means (n = to 6); vertical bars indicate the standard error of the mean The...
  • 13
  • 455
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Genetic relationship between cyclic ovarian activity in heifers and cows and beef traits in males" ppt

... 3–4; 5–6 and 7+ years) Cyclicity and beef traits: genetic relationship Twinningt an Final ageiktn eijktn 279 = fixed effect of type of birth t (2 levels: single or twin) = random additive genetic ... Within the French Charolais breed, a favourable genetic relationship has been revealed between the female growth rate and its ovarian cyclic activity at puberty and after calving [13,14] This relationship ... body traits (BWc and BCSc ) and reciprocally (ICP vs BW12 and BCS12 ) were all negative (from −0.20 to −0.41) Cyclicity and beef traits: genetic relationship 283 3.5 Genetic relationship among...
  • 15
  • 242
  • 0
Báo cáo y học:

Báo cáo y học: "Vascular Endothelial Growth Factor (VEGF) isoform expression and activity in human and murine lung injury" pps

... In order to investigate this possibility we repeated this analysis in snap frozen lung tissue from our multiple dose LPS-induced lung injury model at day post initial injury, reflecting early ... key source [5,6,34] Several lines of in vitro evidence have pointed to a possible role for VEGF in lung repair and recovery following injury[19,29,35,36] In one LPSinduced murine model of lung ... subject to biological heterogeneity inherent in primary cell studies and our preliminary findings need to be expanded upon and analysed individually in greater depth using techniques such as laser...
  • 12
  • 313
  • 0
Báo cáo y học:

Báo cáo y học: " Influence of genetic variations in TLR4 and TIRAP/Mal on the course of sepsis and pneumonia and cytokine release: an observational study in three cohorts" pdf

... LPS Concentrations of TNF-α and IL-6 in cell supernatants of patients bearing the wild-type phenotype and of carriers of TIRAP/Mal or TLR4 polymorphisms showed an increase of cytokine levels Individuals ... potentially linked to an altered stress response and may therefore influence severity of sepsis However, data on the influence of TIRAP/Mal variants on the stress-hormone axis are lacking to date The TLR4 ... JMWvdM and KZ contributed to conception and design of the study Statistical analysis was performed by OK and EJG-B RRS headed the project, supervised and conducted the study OK, EJG-B, AK and RRS...
  • 11
  • 429
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Further insights of the variance component method for detecting QTL in livestock and aquacultural species: relaxing the assumption of additive effects" pptx

... structures; then we performed the testing regimes used first for detecting the presence of a segregating QTL (with or without using information of dominance) and then we made inferences about the mode of ... heritability of the QTL and the actual bias is clearly a function of the magnitude of the dominance variance explained by the QTL (Fig 3) Due to the fact that the power of the variance component method ... without including dominance to detect the QTL and the LR test for detecting dominance (using the GENOTYPIC test) The examples are given for complete dominance (a) and overdominance at the QTL (b) The...
  • 22
  • 287
  • 0
unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh tt

unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh tt

... NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES POST-GRADUATE DEPARTMENT == == = == = == = == = == = == NGUYỄN THANH TÂM UNMARKED PLURAL NOUNS IN ENGLISH AND THEIR DIFFICULTIES FOR THE 1ST YEAR STUDENTS ... find out what teaching methods they are using when dealing with unmarked plural nouns in English, what difficulties they find from their students in their learning unmarked plural nouns in English, ... plural nouns in English Additionally, in order to find out the difficulties of unmarked plural nouns in English for the 1st year students at the Faculty of Tourism, HUC, this study adopts quantitative...
  • 17
  • 693
  • 0
unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh

unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh

... teaching English to the 1st year students at the Faculty of Tourism at HUC to find out what teaching methods they are using when dealing with unmarked plural nouns in English, what difficulties they ... out the difficulties in using unmarked plural nouns in English faced by the 1st year students at the Faculty of Tourism, HUC and seeking for possible solutions to the problems Methodology The theoretical ... matter has been carried out at HUC Therefore, the situation encouraged the author to a research on Unmarked plural nouns in English and their difficulties for the 1st year students at the Faculty...
  • 56
  • 948
  • 1

Xem thêm

Từ khóa: imaging the dynamics of neocortical population activity in behaving and freely moving mammalsdesign and testing of regulatory cassettes for optimal activity in skeletal and cardiac musclesexpectation value of neural activity in noiseless and noisy neural nets with poisson distributed connectivitiesnature of land rights in deccan and south india during the 1617th centuriescapital structure in small and medium sized enterprises the case of vietnam pdfsteroidogenic enzyme 17 20 lyase activity in cortisolsecreting and non functioning adrenocorticadeformations in mechanisms and load distribution over the mated surfaces of parts4 physical activity in children and adolescents with chdwave phasic activity in sleep and its relation to dreamingthe role of manned submersibles in sedimentological and faunal investigations on the united kingdom continental shelfaccounting only for p gp efflux activity in heart and brainconcentration enzyme activity and residual enzyme activity in il and il mixturesgrants donations and bequests shall be recognised in profit and loss distinguishing between the followingdifferences in concepts and implementation arrangements between the european toolsnavigation techniques in augmented and mixed reality crossing the virtuality continuumBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP