... With Solid Fuels, a Deadly Risk of Indoor Air Pollution
Written by Lawan Davis
29 May 2006
I’m Steve Ember with the VOA Special English Development Report.
The World Health Organization says ... report about the dangers of solid
fuels. The report says these fuels are the cause of one and one-half million deaths each year.
Two out of three deaths happen in Sout...
... Sensors Capable of
Measuring and Evaluating Indoor Air Quality.
Indoor Environ., 1, 27–34 (in Japanese).
126
)Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka,
M., Yoshimura, T., Chikara, H., Takigawa, T.,
Morimoto, ... (in Japanese).
113
)Sakai, K., Kamijima, M., Sh ib ata, E., Ohn o, H. and
Nakajima, T. (2009) Annual transition and seasonal
variation of indoor air pollution leve...
... acceptation
inégale par la collectivité.
1086 The International Journal of Tuberculosis and Lung Disease
La contaminación doméstica es relevante para la salud,
ya que pasamos la mayor parte ... 74%, and 74% in sub-Saharan
Africa, South-East Asia, and the Western Paci c Re-
gion, to 36% in the Eastern Mediterranean Region,
and 16% in Latin America and the Caribbean and in
Central and ....
... quality have been published by
ASHRAE, ACGIH, EPA-NIOSH (USA), CSA
(Canada), OSHA, Health and Welfare (Canada),
BSERA.
People have become more aware of environmental
pollution, acid rain, ... 121-127
Aerobiologia
lat~rattlelal Journal of
Aembiolosy
Impact of indoor air pollution on health, comfort and productivity
of the occupants
Jagjit Singh*
Associate Director, Osc...
... nonsense mutations may have
advantages for organisms with relatively long lifespans
and small numbers of offspring.
Calculating F is a novel tool for addressing codon
usage bias in genes and genomes. ... Flegel
*
Abstract
Background: Codon usage in genomes is biased towards specific subsets of codons. Codon usage bias affects
translational speed and accuracy, and it is associated wit...
... duodenal solitary Peutz-Jeghers
type hamartomatous polyp. Case 1 was a hamartoma-
tous polyp with a focus of well-differentiated adenocar-
cinoma, and Case 2 was a hamartomatous polyp with
Table ... Duodenal hamartoma: apropos of a case report. Radiol Med
1989, 77:134-136.
12. Tanaka H, Iida M, Kohrogi N, Matsui T, Yasunami Y, Yao T, Nakamura K,
Fujishma M: Endoscopic removal...
... 344:699-709.
3. Abraham E, Laterre PF, Garg R, Levy H, Talwar D, Trzaskoma BL,
Francois B, Guy JS, Bruckmann M, Rea-Neto A, et al., for the
Administration of Drotrecogin alfa (activated) in Early Stage
Severe ... PROWESS of 24.97% and 75.03%, respectively. The risk ratios (RR) and odds ratio (OR) are plotted on a
natural logarithm scale. n/N equals number of deaths at 28 days/numbe...
... in
Developing Asian and Pacific Countries, Policy Uses of
Particulate Exposure Estimates, Total Exposure as the Basis
of Economic Valuation of Air Pollution in India, Indoor Air
Pollution (in Health and Air ... Research Program at the
East-West Center. He is also Affiliate Faculty at the
Department of Urban And Regional Planning, University of
Hawai`i at Manoa. He has a...
... the
Quikchange Site-Directed Mutagenesis kit (Stratagene, La
Jolla, CA, USA) with forward primer 5¢-GAAACGATGC
ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse
primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA
TCGTTTC-3¢. ... 5¢-
CATATGGATGAGTACAAACA
AGTAGATG-3¢ and reverse primer 5¢-
GGATCCTCGAG
CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin-
ed sequences indicate NdeI and BamHI sites, respectively).
The PCR prod...