Báo cáo y học: "Usefulness of N-terminal pro-brain natriuretic peptide and C-reactive protein to predict ICU mortality in unselected medical ICU patients: a prospective, observational study" pot
Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx
... SOX catalyses the o xidative demethylati on of
sarcosine (N-methylglycine) to form glycine and formalde-
hyde. Similarly, DAAO catalyses the oxidative d eamination
of neutral and (with a lower ... oxidize
D
-proline,
D
-alanine and
D
-2-aminobutyrate with similar relative
efficiencies. Analogously, GO and MSOX show a fairly
similar activity o n s arcosine and N-ethylglycine...
Báo cáo y học: " Lack of correlation between pulmonary disease and cystic fibrosis transmembrane conductance regulator dysfunction in cystic fibrosis: a case report" pot
... reasonable patient or their
family to object to publication of this case report and any
accompanying images.
Competing interests
The authors declare that they have no competing interests.
Authors' ... this article as: Levy et al., Lack of correlation between pulmonary dis-
ease and cystic fibrosis transmembrane conductance regulator dysfunction
in cystic fibrosis: a case...
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... the in vivo and cellular assays and analysis and
interpretation of data, EJM, MW and CL participated in the design of the
study and analysis and interpretation of data. HB conceived of the study,
participated ... sense ATAGGATCCTGCTAAGACTCCCCACCGTAA
2
Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT
3
Negative sense RNA-specific cDNA...
Báo cáo y học: "Clustering of phosphorylation site recognition motifs can be exploited to predict the targets of cyclin-dependent kinase" potx
... we introduce
a new computational strategy to predict the targets of CDKs and use it to identify new biologically
interesting candidates. Our data suggest that regulatory modules may exist in protein ... each of those proteins.
Additional data files
The following additional data are available with the online
version of this paper. Additional data file 1 contains the S. cer-...
Báo cáo y học: " Usefulness of case reports to improve medical knowledge regarding trigemino-cardiac reflex in skull base surgery" doc
... subdural
empyema drainage: A case report. J Med Case Reports 2010, 4:391.
14. Acioly MA, Carvalho CH, Koerbel A, Löwenheim H, Tatagiba M,
Gharabaghi A: Intraoperative brainstem auditory evoked potential
observations ... that deal only with case
reports and of making great efforts to achieve a high
qua lity of publi cation also in c ase reports and to stimu-
late authors t...
Báo cáo y học: "Usefulness of procalcitonin for diagnosis of sepsis in the intensive care unit" doc
... discrimination of sepsis and SIRS by determination of
circulating plasma concentrations of PCT, IL-6 and C 3a in a
medical ICU. Their data indicated that of PCT, IL-6 and C 3a
concentrations are more ... K:
Discriminative power of inflammatory markers for prediction of
tumor necrosis factor-alpha and interleukin-6 in patients with
systemic inflammatory response...
Báo cáo y học: "Usefulness of C-reactive protein in monitoring the severe community-acquired pneumonia clinical course" ppsx
... day 3 of
antimicrobial therapy. The indicative accuracy of these varia-
bles at day 3 was assessed by calculation of the area under
the curve (AUC), as described elsewhere [14]. In medical
practice, ... the C-reactive protein ratio during antibiotic therapy. Time-dependent analysis of the C-reactive protein (CRP) ratio dur-
ing antibiotic therapy, from day 0 to day 7 of...
Báo cáo y học: " Usefulness of open lung biopsy in mechanically ventilated patients with undiagnosed diffuse pulmonary infiltrates: influence of comorbidities and organ dysfunction" pdf
... multivariate
analysis, the early, rather than late, use of OLB seems to have
a survival advantage.
When a patient is intubated and mechanical ventilation is initi-
ated as a result of respiratory failure of unknown ... respiratory
failure was unclear. This is reflected by the time of OLB after
the initiation of mechanical ventilation, which was a median of
11 days in...
Báo cáo y học: "Usefulness of manufactured tomato extracts in the diagnosis of tomato sensitization: Comparison with the prick-prick method" pdf
... Parietaria
judaica, and Platanus hybrida); mites (Dermatophagoides
pteronissynus and D. farinae); moulds (Alternaria alternata
and Cladosporium herbarum) and animal danders (cat and
dog epithelia). ... and prick-prick
tested with fresh ripe peel of Canary variety tomato. All
manufactured extracts were kindly supplied by Laborato-
rios LETI S.L., Spain.
Tomato extracts
The Canary...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Chuong 2 nhận dạng rui ro
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật