Báo cáo y học: "The leading causes of death after burn injur

Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx

... the majority of pediatric burn patients was male, had suffered a flame burn injury and had 23% TBSA burn. Inhalation injury was present in 20% of all admitted burns. Respiratory failure Respiratory ... syndrome (ARDS), as defined clinically, diffuse alveolar damage (DAD) based solely on findings at autopsy, aspiration or asphyxia, or asthma attack. ARDS was clinically def...

Ngày tải lên : 13/08/2014, 20:21

7
265
0

Báo cáo y học: "The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology" docx

... below). Catalytically dead kinases In most kinomes, about 10% of kinases lack critical cata- lytic residues (K72, D166, D184) and are likely to be catalytically inactive, yet may retain signaling ... (Orf_14367) of adenylate and guany- late cyclases. No clear AKAP (A kinase anchoring pro- tein) was found. In many organisms, including Giardia, PKA localizes to the basal bodies/centr...

Ngày tải lên : 09/08/2014, 23:20

20
491
0

Báo cáo y học: " The functional expression of extracellular calcium-sensing receptor in rat pulmonary artery smooth muscle cells" potx

... The CaSR is important in m aintaining and regulating mineral ion homeostasis. Increasing evidence has indicated that CaSR was functionally expressed in the cardiovascular system. Wang et al showed ... China. 2 Department of Pathophysiology, Harbin Medical University, Harbin 150086, PR China. 3 Department of Pharmacology, Har bin Medical University, Harbin 150086, PR China. 4 Bio-pharm...

Ngày tải lên : 10/08/2014, 05:21

8
350
0

Báo cáo y học: "The pathophysiological function of peroxisome proliferator-activated receptor-γ in lung-related diseases" pptx

... Tanahashi M, Yukiue H, Moiriyama S, Kobayashi Y, Nakashima Y, Kaji M, Kiriyama M, Fukai I, Yamakawa Y, Fujii Y: Decreased perioxisome proliferator-activated receptor gamma gene expression was ... purposes) nophil and lymphocyte influx may not be mediated by the antagonism of the NF-κB pathway [31]. Interleukin-5 (IL-5) is the principal regulatory cytokine mediating eosinophil airway i...

Ngày tải lên : 12/08/2014, 18:22

9
262
0

Báo cáo y học: "The temporal program of peripheral blood gene expression in the response of nonhuman primates to Ebola hemorrhagic fever" ppsx

... (lanes B and D), day 2 after infection (lane E), day 3 after infection (lane F), day 4 after infection (lanes H and J), day 5 after infection (lanes L, N, and P), day 6 after infection (lane ... smears. Cytokine and chemokine ELISAs Cytokine/chemokine levels in monkey sera/plasma were assayed using commercially available ELISA kits according to manufacturer's directions. Cyt...

Ngày tải lên : 14/08/2014, 08:20

14
601
0

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... on all abnormalities [12]. At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands [13]. There may be advantages to eliminating daily routine ... 22:1335-1338. 9. Chahine-Malus N, Stewart T, Lapinsky SE, Marras T, Dancey D, Leung R, Mehta S: Utility of routine chest radiographs in a medical-surgical intensive care unit: a qualit...

Ngày tải lên : 25/10/2012, 10:39

7
722
0

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

... amplified by two primer pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... including the mutation was obtained by using primers CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subs...

Ngày tải lên : 10/08/2014, 05:20

4
384
0

Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

... report Daisuke Yoshioka, Toshiki Takahashi * , Toru Ishizaka and Takuya Higuchi Abstract Cardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare. Infected ... toshiki@onh.go.jp Department of Cardiovascular surgery, Osaka National Hospital, 2-14 Hoenzaka, Chuo-ku, Osaka city, Osaka, 540-0006, Japan Yoshioka et al. Journal of Cardiothoracic S...

Ngày tải lên : 10/08/2014, 09:21

4
543
0

Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"

... requiring substantial investments of additional resources. Academic centers are increasingly recognizing engagement in quality improvement as a distinct career pathway. Involving such physicians in ... the standardized MET form on each patient and a weekly 1-hour Commentary The evolving story of medical emergency teams in quality improvement André Carlos Kajdacsy-Balla Amaral 1...

Ngày tải lên : 25/10/2012, 10:06

2
427
0

Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"

... reconstruction with cartilage grafts covered by axial, random and free flaps of temporoparietal fascia, anatomical researches of temporal area gained populari- ty. 4 When its advantages are combined with ... face and scalp. In: Gray’s Anatomy The anatomical basis of clinical practice, 39th ed. Elsevier Churchill Livingstone; 2005: 497-519. 10. Mathes SJ, Nahai F. Regional Flaps...

Ngày tải lên : 25/10/2012, 11:00

7
727
0