... MR-
proADM (amino acids 45–92) and has an analytical detection
limit of 0.08 nmol/l. Intra-assay imprecision was under 10%
over the entire measuring range, and the functional assay sen-
sitivity (interassay ... Marutsuka K, Nawa Y, Asada Y, Hara S, Kitamura K, Eto T, Sumiy-
oshi A: Adrenomedullin and proadrenomudullin N-terminal 20
peptide (PAMP) are present in human colonic epithelia an...
... mg/kg azaperone and 0.02 mg/kg atropine
intramuscularly) with 0.01 mg/kg fentanyl (Fentanyl; Janssen
Pharmaceuticals, Neuss, Germany) and 5 mg/kg thiopentone
(Trapanal; Altana Pharma, Konstanz, ... PaCO
2
at
unchanged HFOV settings indicates a decreased alveolar sur-
face available for gas exchange.
Previous studies in the lavage animal model showed that CO
decreased at high mean airway...
... MINIREVIEW
Pharmacologic chaperoning as a strategy to treat Gaucher
disease
Zhanqian Yu, Anu R. Sawkar and Jeffery W. Kelly
Department of Chemistry and The Skaggs Institute for Chemical Biology, ... mechanisms.
Proc Natl Acad Sci USA 103, 13813–13818.
29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain
P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-
oxynojirimycin as a pharma...
... recovered
differentially based on varying stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis ... We have suc-
cessfully adapted a phage-display method for quantitating
a nities of protein variants (shotgun alanine scanning) to
analysis of GB1 stability. Using this me...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. The resulting PCR prod-
ucts, ... (C
J
glucose
las
% 0 and C
J
l
las
% 0) as can be inferred
from the primary data. However, it is interesting that
a slight red...
... without
being changed by the action. Atoms are printed in
boldface iff they contradict the goal.
This plan can be read as a derivation tree that has
one node for each action instance in the plan, and an
edge ... gener-
ation with TAG grammars and semantic and prag-
matic information can be encoded into PDDL. Our
encoding is declarative in that it can be used with
any correct plann...
... discriminant analysis (LDA).Thisstatistical
multivariate method is supervised. It searches for the
variables containing the greatest interclass variance and
the smallest intraclass variance, and constructs ... Many
parameters can be adjusted for increasing the efficiency of
the algorithm. The data were analysed with a window of five
wavenumbers, assuming that adjacent wavenumbers are
highly c...
... 5204–5210.
28. Sharath, A. N., Weinhold, E. & Bhagwat, A. S. (2000) Reviving a
dead enzyme: cytosine deaminations promoted by an inactive
DNA methyltransferase and S-adenosylmethyonine analogue.
Biochemistry ... of
2-pyrimidinone containing DNA as a MTase inhibitor.
2-pyrmidinone incorporation in DNA sequences may also
serve as a specific probe for studying discrimination
c...
... polyclonal ASA antiserum.
Precipitated ASA was quantified after
SDS ⁄ PAGE with a bio-imaging analyser
(Fujifilm). Columns show mean, minimal and
maximal deviation of arbitrary units of two
independent ... Sci
USA 80, 6066–6070.
13 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler-
ated transport and maturation of lysosomal alpha-galac-
tosidase A in Fabry lymphoblasts by an enzyme...
... Using spreading activation,
the syntactic category aspect of each meaning in
turn activates the category's meaning in the
grammar space representation.
Part
of
the grammatical meaning ...
grammar, and pragmatic or local context, receive
support as separately definable knowledge within
studies of aphasia. There is a vast literature
concerning what aspects of language are...