Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc

Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc

Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc

... 10:26 http://www.ann-clinmicrob.com/content/10/1/26 Page 4 of 7 RESEARCH Open Access Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance ... We studied bactericidal activity of oxacillin, vancomycin and teicoplanin against Staphylococcus...
Ngày tải lên : 12/08/2014, 17:20
  • 7
  • 356
  • 0
Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx

Báo cáo hóa học: "High activity of sequential low dose chemo-modulating Temozolomide in combination with Fotemustine in metastatic melanoma. A feasibility study" pptx

... MJ, et al: Activity of fotemustine in medulloblastoma and malignant glioma xenografts in relation to O6- alkylguanine-DNA alkyltransferase and alkylpurine-DNA N-glycosylase activity. Clin Cancer ... limit in 3 patients. According to AJCC melanoma staging [2], 2 patients had M 1a staging, 4 patients had M1b staging, and 8 patients had M1c staging. Two patie nts had onl...
Ngày tải lên : 18/06/2014, 16:20
  • 8
  • 459
  • 0
Báo cáo y học: "The effects of long-acting bronchodilators on total mortality in patients with stable chronic obstructive pulmonary disease" pdf

Báo cáo y học: "The effects of long-acting bronchodilators on total mortality in patients with stable chronic obstructive pulmonary disease" pdf

... accounting of all randomized patients in the study and reported excellence balance in terms of patient characteristics and clinical status between the active treatment and comparator arms. Sec- ondly, ... Foundation for Health Research DDS is a Canada Research Chair in COPD and a senior scholar with the Michael Smith Foundation for Health Research (MSFHR) and...
Ngày tải lên : 12/08/2014, 11:21
  • 13
  • 437
  • 0
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt

Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt

... Tamura D, Sakai- Tagawa Y, Noda T et al.: In vitro and in vivo characterization of new swine-origin H1N1 influenza viruses. Nature 2009, 460:1021–1025. 3. Kashiwagi T, Hara K, Nakazono Y, Hamada ... endonuclease activity, cap binding, and virion RNA promoter binding. J Virol 2006, 80:7789–7798. 18. Obayashi E, Yoshida H, Kawai F, Shibayama N, Kawaguchi A, Nagata K, Tame JR, Pa...
Ngày tải lên : 18/06/2014, 18:20
  • 15
  • 237
  • 0
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf

báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf

... 2001, 10(4):254-265. 34. Charest CA: Analysis of a transcultural innovation: the social- isation of Filipino-graduate nurses into an acute health care organisation in the United States. In Graduate School Volume Doc- tor ... nursing workforce in sub- Saharan Africa. In Issue Paper no 7 Geneva , International Council of Nurses; 2005. 29. Kline D: Push and pull factors in...
Ngày tải lên : 18/06/2014, 17:20
  • 7
  • 473
  • 0
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

... Khartoum, Sudan and 5 World Health Organization Country Office, Lusaka, Zambia Email: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int; ... proposal, discussions, data analysis and review of the article. SH, ETAES and HM were involved in data collection, discussion and review of arti- cle. All aut...
Ngày tải lên : 18/06/2014, 17:20
  • 8
  • 628
  • 0
Báo cáo sinh học: " PET kinetics of radiolabeled antidepressant, [N-methyl-11C]mirtazapine, in the human brain" ppt

Báo cáo sinh học: " PET kinetics of radiolabeled antidepressant, [N-methyl-11C]mirtazapine, in the human brain" ppt

... temporal cortices, intermediate binding potential in the thalamus, and low binding potentials in the striatum, hypothalamus, and brainstem. Thereafter, we initiated PET studies with arterial sampling ... [N-methyl-11C]mirtazapine data, perhaps resulting in biased estimates of parameters. The values for the binding potential of [N-methyl- 11 C]mirtazapine obtained by metho...
Ngày tải lên : 18/06/2014, 18:20
  • 18
  • 432
  • 0
Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt

Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt

... performing study and editing manuscript XDW: making study plan and advising data analysis as well as writing manuscript JH: making study plan and advising data analysis as well as writing manuscript All ... wax, stained with hematoxylin and eosin, and examined under a light microscope. The lung injury was scored according to inflammatory changes, hemorrhage of alveoli and in...
Ngày tải lên : 18/06/2014, 19:20
  • 9
  • 799
  • 0
Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

... stimulated with anti-CD3/CD28 beads and 5-day supernatants were screened by cytokine bead assays (average and SD of 3 animals). Vong et al. Journal of Translational Medicine 2011, 9:101 http://www.translational-medicine.com/content/9/1/101 Page ... of cytokine production, in vitro stimula- tion of lymphocytes isolated from pancreas with anti- CD3 and anti-CD28 b eads (Invi...
Ngày tải lên : 18/06/2014, 19:20
  • 10
  • 447
  • 0
Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

... CACCTCAGTCACCTGCATGGCCA CCR5 ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCA CCR6 TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT CCAAGAGGCACAGAGCCATCCGA CCR7 CTGCTACCTCATTATCATCCGTACCT TGATCACCTTGATGGCCTTGT ... CAGCCATTTTGCCAGTGGTA ACATGCCTTTGAAACAGCTGCCGAA CCR2 ATGAGTAACTGTGTGATTGACAAGCA GCAGCAGTGTGTCATTCCAAGA CTCTGTCACCTGCATGGCCTGGTCT CCR3 ACCAGCTGTGAGCAGAGTAAACAT CACA...
Ngày tải lên : 18/06/2014, 22:20
  • 12
  • 307
  • 0

Xem thêm

Từ khóa: