Báo cáo y học: "Protective effect of budesonide/formoterol compared with formoterol, salbutamol and placebo on repeated provocations with inhaled AMP in patients with asthma: a randomised, double-blind, cross-over study" ppsx
... effect of budesonide/formoterol
compared with formoterol, salbutamol and placebo on repeated provoca-
tions with inhaled AMP in patients with asthma: a randomised, double-blind,
cross-over study ... compared with formoterol alone, salbutamol and
placebo. In addition all three active treatments significantly increased FEV
1
within 3 minut...
... vasoactive intestinal peptide and pituitary
adenylate cyclase-activating polypeptide on osteoclast forma-
tion are associated with upregulation of osteoprotegerin and
downregulation of RANKL and RANK. ... (collagen-
induced arthritis (CIA) [6] accompanied by infiltration of the
synovial membrane and synovial cavity as well as by extensive
local bone and cartilage destructi...
... -3' and 5'-
TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'),
Der p 2 (5'- CCGGAATTCGCCGCCACCATGGAT-
CAAGTCGATGTCAAAGATTGTGCC -3' and 5'-
TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAG-
CAAT ... CCGGAATTCGCCGCCACCAT-
GGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'-
TGCTCTAGATTAGAGGTTGTTTCCGGCTT-
GGAAATATCCG -3'), Der f 2 (5'-
CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGT-...
... pathways in tubular cells via cas-
pase activation and Fas up-regulation [8-10]. In addition,
in experimental animal models of sepsis, a broad range
of functional alterations of tubular re-absorption ... Santa Cruz Biotech, Santa Cruz, CA, USA). After
incubation with primary antibodies, samples were
washed with one times PBS and incubated with appro-
priated Alexa Fluo...
... Fisher, A. , Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino
acid residue 147 of human aldosterone synthase and 11beta-
hydroxylase plays a key role in 11beta-hydroxylation. J. Clin.
Endocrinol. ... (Mock) an d the c DNA o f b ovine
Adx.Datashownaremeans±SEMoffourseparatetransfections,
each done in duplicate. (B) Determination of 11b-hydroxylase capacity
of CYP11B2 mut...
... stress in patients with wide QRS duration
(20). In contrast, Kurita et al. reported on an increased
mechanical dyssynchrony during pacing–induced
tachycardia in patients with normal QRS duration ... cohort of patients
evaluated in our hemodynamic laboratory. All of these
patients had a normal left ventricular cavity size and
baseline ejection fraction as eva...
... capsaicin and their combination on the damage
caused to liver by iron overloading measured in terms
of lipid peroxidation and elevation of plasma alanine
aminotransferase (AlAT), aspartate aminotransferase
(AsAT) ... curcumin, capsaicin
and their combination on carrageenan induced
in ammation
To examine the postlocal anti -in ammatory potential of
the combination of spice...
... such as histidine, DABCO, and
n-propyl gallate, retarded the above damages to the
antenna proteins indicating mainly
1
O
2
was involved
[28]. In spinach thylakoids, illumination at low light
intensity ... plastocyanin [31,32]. In the
present study, the degradation of each polypeptide and
the protein conformation changes are assessed in con-
nection with alterations in photoche...
... They all concern acute mania and antipsycho-
tics (FGAs and SGAs against acute mania and SGAs in
maintenance protecting from m ania). Four effect cases
are not adequately studied (FGAs against acute ... R,
Walker D, Tran P, Breier A: A double-blind, randomized comparison of the
efficacy and safety of intramuscular injections of olanzapine, lorazepam,
or placebo in t...