báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx
Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx
... splicing is
important for ES cell self-renewal and differentiation
[3]. However, the mechanisms by which molecules that
Keywords
cell cycle; embryonic stem cells; knockout
mouse; polypyrimidine tract-binding ... viable,
they form compact colonies and exhibit severe defects
in cell proliferation without precocious differentiation.
Our data clearly demonstrate that PTB...
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris,
France): 5forGulox (forward), 5Â-GGGGACAAGTTT
GTACAAAAAAGCAGGCTTCGATGACGACGACAAG
ATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev-
Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAA
GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT
A- 3Â. ... Mycobacterium tuberculosis possesses a functional
enzyme for the synthesis of vitamin C,
L-gulono-1,4-lactone dehydrogenase
Beata A. Wolucka
1
an...
Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf
... nuclear localization
for the mSMOl isoform (Fig. 4).
Taken together, these results consistently substanti-
ate the hypothesis that these two structural regions are
mandatory for the nuclear localization ... M. Bianchi et al.
3054 FEBS Journal 272 (2005) 30523059 ê 2005 FEBS
Two short protein domains are responsible for the nuclear
localization of...
Báo cáo khoa học: "Feature-Rich Part-of-speech Tagging for Morphologically Complex Languages: Application to Bulgarian" docx
... the wordform, OldEnd is
the string that has to be removed from the end of
the wordform, and NewEnd is the string that has
to be concatenated to the beginning of the word-
form in order to produce ... Association for Computational Linguistics, pages 492–502,
Avignon, France, April 23 - 27 2012.
c
2012 Association for Computational Linguistics
Feature-Rich Part-of-speech Tagging...
Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot
... member of a
unique branch of the kinome in which downstream signaling occurs in both
ligand- and receptor- expressing cells. Consequently, the ephrins and ephrin
receptor tyrosine kinases often ... School of Medicine, New Haven, CT, USA
Introduction
The ephrin receptor class of receptor tyrosine kinases
(EPH RTKs) is the largest subgroup of RTKs in the
k...
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... concom-
itant appearance of inosine (Fig. 1A) . Incubation times
longer than 30 min in the presence of H
2
O
2
did not greatly
change the ratio SATP + ADP + AMP/Ino. Similar
changes in ATP and inosine ... for 30 min, an important decrease in the
ATP, and a less extensive decrease in the GTP, CTP, UTP
and ADP-ribose levels was estimated. Concomitantly...
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... 2,3,7,8-
tetrachlorodibenzo-p-dioxin-induced signal transduction
pathway leading to apoptosis in L-MAT, a human
lymphoblastic T-cell line
Sohel Ahmed, Masahiko Shibazaki, Takashi Takeuchi and Hideaki Kikuchi
Department of Molecular Genetics, ... molecular mechanism
involved in the immunotoxicity of TCDD.
In summary, we suggest that PKCh kinase activity i...
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... enhancer factor 2B is involved in the inducible
expression of NOX1
⁄
NADPH oxidase, a vascular
superoxide-producing enzyme
Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, Tomoko Kakehi, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-
agishi M, Taira K & Yabe-Nishimura C (2005) Essen-
tial role of ATF-1 in induction of NOX1, a catalyt...
Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx
... MINIREVIEW
Active-site-specific chaperone therapy for Fabry disease
Yin and Yang of enzyme inhibitors
Jian-Qiang Fan
1
and Satoshi Ishii
2
1 Department of Human Genetics, Mount Sinai School of Medicine, ... the
development of ASSC therapy for Fabry disease. Par-
ticularly, 1-deoxygalactonojirimycin (DGJ) is explored
as an example of the development of...
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... ATPase activity of RecD is essential for growth of the
Antarctic Pseudomonas syringae Lz4W at low temperature
Ajit K. Satapathy, Theetha L. Pavankumar, Sumana Bhattacharjya, Rajan ... Nonetheless, the
present study identifies the significance of the RecD-
associated ATPase activity required during the growth
of P. syringae at low temp...
Báo cáo khoa học: DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulfite reductase pptx
... studies of the role of SiR in chloroplast
nucleoids, SiR was suggested to repress DNA synthesis
[26] and transcription [27] within nucleoids. Relaxing
the DNA compaction of nucleoids by release of ... repression
than ZmSiR. Based on the results of the DNA- binding
study, the tighter compaction of DNA induced by
PsSiR was a result of its stronger binding...
Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc
... al. Alternative promoter usage for Xenopus MGP gene
FEBS Journal 272 (2005) 15011510 ê 2005 FEBS 1503
Identification of alternative promoter usage for the matrix
Gla protein gene
Evidence for differential ... signa-
ling plays a critical role in dorsoventral patterning and
neural induction during early Xenopus development
[32], the presence...
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... the
mapping of the linguistic tests to comparisons of
quantitative variables was in most cases straightfor-
ward, and always at least plausible.
The analysis of the linguistic tests and their ...
models to perform badly.
8 Conclusions and Future Work
We have presented a quantitative analysis of the per-
formance of measurable linguistic tests for t...
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot
... to
RT-mix for synthesis of cDNA. The RT-mix consisted of
6
à
l of 5X Universal buffer, 3
à
l of 0.1
à
l M DDT, 1
à
l of 10
mM dNTP, 1
à
l of reverse primer (20 pM), 1 of Superscript
reverse transcriptase ... Seoul 151-742, Korea
One step TaqMan reverse transcription polymerase
chain reaction (RT-PCR) using TaqMan probe was
developed for detection of Japa...
báo cáo khoa học: " Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight" pptx
... potato does not result in lethality.
However, the Sgt1 gene is essential for the RB-mediated late blight resistance. In contrast, the Rar1
gene is not required for RB-mediated resistance. These results ... purposes)
BMC Plant Biology
Open Access
Research article
Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum
resistance...
Từ khóa:
- báo cáo khoa học
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- báo cáo khoa học về cá tra
- báo cáo khoa học nghiên cứu chôm chôm
- trạng thái hiện sinh báo cáo khoa học
- biểu tượng văn học báo cáo khoa học
- tài liệu báo cáo khoa học
- cách trình bày báo cáo khoa học
- báo cáo khoa học toán học
- cách làm báo cáo khoa học
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật