báo cáo khoa học: " Analysis of a c0t-1 library enables the

báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

... ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCT AAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGT TTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGT TTTTTGGGTTTCATGTTCCT HinfI -satellite 325 2 ... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCC...

Ngày tải lên : 12/08/2014, 03:21

14
270
0

báo cáo khoa học: "MeRy-B: a web knowledgebase for the storage, visualization, analysis and annotation of plant NMR metabolomic profiles" potx

... application and database for the management and analysis of NMR plant metabolomics profiles, filling the gap in centralized informat ion in this area. This platform manages all the data produced by a metabolomics ... files, as such files are already available as part of the quality assurance approach operating in most laboratories: standard operating proce- dures (...

Ngày tải lên : 11/08/2014, 11:21

12
368
0

Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx

... supervised and partic- ipated in the practical work and neutrophil counting, assisted in interpretation of the results and was main responsible for supporting the drafting and for revision of the manuscript. ... respectively. However, a significant increase was recorded again in the afternoon milking day 3 and the protein percentage there- after remained sign...

Ngày tải lên : 12/08/2014, 18:22

10
397
0

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... protein, lacking the copper binding domain is cap- able of domain swapping and forms a dimer as revealed by crystal structure analysis [36]. In our case, SEC data collected for samples at pH 7 have ... pH 5 using 5m M Mes as a buffer. Shown are stefin A and stefin B at pH 5 and variant 2 of stefin B and the P79S mutant of the variant at both pH 7 and pH 5. Each...

Ngày tải lên : 19/02/2014, 06:20

14
586
0

Báo cáo khoa học: Recent insights into cerebral cavernous malformations: the molecular genetics of CCM pot

... identiﬁcation of several of the biochemical pathways involving CCM proteins as well as the analysis of several ﬁsh and mouse CCM animal models has already provided a number of clues to this goal (see Faurobert ... sporadically and in a familial context. The proportion of familial cases has been esti- mated to be as high as 50% in Hispano-American CCM patients [2]...

Ngày tải lên : 15/03/2014, 10:20

6
356
0

Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx

... Sasaki K, Kurata K, Funayama K, Nagata M, Watana- be E, Ohta S, Hanat N & Nishi T (1994) Expression cloning of a novel a1 ,3-fucosyltransferase that is involved in biosynthesis of the sialyl ... con- taining 10% fetal bovine serum, penicillin and streptomy- cin as described previously [5,20]. In the treatment of InR kinase inhibitor and SLe x mAb, the ﬁnal concentra...

Ngày tải lên : 16/03/2014, 12:20

13
354
0

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

... Silverman and R. Linsker, A measure of DNA periodicity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300, 1986. [23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and ... A very similar characteristic is observed in the distribution of distances between TT to TT dinucleotides in [11], and in the distribution of AAAA to AAAA tetramer d...

Ngày tải lên : 22/06/2014, 00:20

8
382
0

Báo cáo khoa học: "How do plant defense compounds influence the oviposition behaviour of small cabbage white butterfly Pieris rapae (Linnaeus)" potx

... were artificially damaged and treated with the regurgitant of Spodoptera exigua larvae on the damaged site, produced the same blend of volatiles as plants that are damaged by the caterpillars ... Zevenbergen ** , Maaike Bruinsma ** and Joop van Loon ** * Research affairs and International cooperation office ** Entomology laboratory- Wageningen University- The Neth...

Ngày tải lên : 06/08/2014, 19:20

8
255
0

báo cáo khoa học: " Ovarian cryopreservation after laparoscopic ovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a woman: a case report" ppt

... surgical management. JL and AM performed the ovarian cryopreservation and were major contributors in writing the manuscript. All authors read and approved the final manuscript. Competing interests The ... CAS E REP O R T Open Access Ovarian cryopreservation after laparoscopic ovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a wo...

Ngày tải lên : 11/08/2014, 00:22

3
203
0

Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

... that the patients were randomised many years after their outcomes had occurred and did not discuss the likelihood that time can go backwards and that prayer can wake the dead. The author of the ... life again. In fact, all the randomi- sation did was to divide the living and the dead into two groups that were then compared statistically. This is meaningless[4], also...

Ngày tải lên : 11/08/2014, 07:21

4
207
0