báo cáo khoa học: " The isolation and mapping of a novel hyd

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

... article The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway Cinzia Comino 1 , Alain Hehn 2 , Andrea Moglia 1 , Barbara Menin 1 , Frédéric ... GGGTTTCATATGACTATCGGAGCTCGTGAT HQT-Rev CGGGATCCCTAGAAGTCATACAAGCATTT HCT-ForRT TTTTTAAGCTAACACGAGAC HCT-RevRT TCTCATAGGAGCTGTAATTG HQT-ForRT TAAAATGGACGATCAGTATC H...

Ngày tải lên : 12/08/2014, 03:20

13
650
0

Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

... reactions. The ﬁrst round of PCR reaction was performed with a forward primer UPM (a mixture of primers 5¢-CTAATACGACTCACTATAGGGC AAGCAGTGGTAACAACGCAGAGT-3¢ and 5¢-CTAAT ACGACTCACTATAGGGC-3¢) and ... PCR reaction was performed using a pair of speciﬁc primers P3 (5¢-GGAAGAATACAGACACGGACAG-3¢) and P4 (5¢-ATAACAACAGTTTATACATCGCTTC-3¢) correspon- ding to the 5¢-untranslated...

Ngày tải lên : 16/03/2014, 23:20

12
375
0

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

... 1297 Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus Santosh Kumar, Ajaswrata Dutta, Alok K. Sinha and Jayanti Sen National Centre for Plant Genome ... Skoog (MS) 3 basal medium by painting on the adaxial surface of the leaves, and the tray containing the leaves was sealed with saran wrap. In control experi- ments, s...

Ngày tải lên : 23/03/2014, 09:21

14
347
0

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The binding afﬁnity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressed O-acetyl ... showing a( 2–6) linkage. The sialic acid afﬁnity of the Paratelphusa lectin was further proved by its inability to inhibit sialidase-treated BSM and bovine thyroglob...

Ngày tải lên : 21/02/2014, 00:20

8
616
0

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... behavior is typical of integral membrane proteins. The polypeptide with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal ... Materials and methods. (A) Data points correspondtotheamplitudeofthetroughcenteredatg ¼ 1.951; as in the low po tential range, the radical signal of the dyes overlap in t...

Ngày tải lên : 21/02/2014, 03:20

10
564
0

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... binding of SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376) in vitro. DNA binding of a protein containing 20 amino acids at the 5¢ end of the DBD, the DBD and the 40 amino acids at the 3¢ end of the ... of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B)...

Ngày tải lên : 07/03/2014, 11:20

16
542
0

Báo cáo khoa học: Identiﬁcation and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc

... pull-down and immunoblotting against anti-HA serum. Coomassie Brilliant Blue staining and anti-HA blotting of the input materials ascertain the equivalent amounts of extracts and peptides between each ... transcriptional activation (amino acids 1–63), N-terminal Elf-1 (amino acids 63–244), the basic (amino acids 244– 250), SPXX (amino acids 250–403), Q ⁄ P (amino acids 403–413...

Ngày tải lên : 16/03/2014, 18:20

13
451
0

Báo cáo khoa học: Puriﬁcation and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... GSTs in insects [2]. The majority of GSTs are in the Delta and Epsilon classes, and the remain- ing enzymes are in the Omega, Sigma, Theta and Zeta classes. The German cockroach (Blattella germanica)isan economically ... Point Richmond, CA, USA). Amino acid sequencing Edman degradation, performed by Proteos, Inc. (Kalama- zoo, MI, USA), was used to determine the am...

Ngày tải lên : 23/03/2014, 09:21

11
426
0

Báo cáo khoa học: Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis pdf

... 2). Activation of class I PI3K inhibits autophagy through activation of protein kinase B (Akt) and mammalian target of rapamycin (mTOR). In contrast, activation of class III PI3K in a complex with the autophagy-associated ... 1-depen- dent autophagy in yeast and mammalian cells [4]. Beclin 1, the mammalian ortholog of yeast Atg6 ⁄ Vps30, was originally discovered in...

Ngày tải lên : 28/03/2014, 23:20

11
742
0

Báo cáo khoa học: Identiﬁcation and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

... 2957 Identiﬁcation and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans Akihiro Morita 1 , Haruhiko Isawa 2 , ... or absence of 1.0 l M triplatin-1 and analyzed by anti-FcR c-chain (aFcR c-chain) and antiphosphotyrosine (aPY) immunoblotting. A. Morita et al. Identiﬁcation and chara...

Ngày tải lên : 30/03/2014, 10:20

8
408
0