báo cáo khoa học:" Biological and biomechanical evaluation o

báo cáo khoa học:" Biological and biomechanical evaluation of interface reaction at conical screw-type implants" doc

... number not for citation purposes) Head & Face Medicine Open Access Research Biological and biomechanical evaluation of interface reaction at conical screw-type implants Andre Büchter* 1 , ... after 28 days of osseointegration. SEM of implantation sites in tibia specimens at different mag-nificationsFigure 5 SEM of implantation sites in tibia specimens at diff...

Ngày tải lên : 11/08/2014, 23:22

9
211
0

Báo cáo khoa học: "Quantitative and Qualitative Evaluation of Darpa Communicator Spoken Dialogue Systems" pdf

... user’s travel plans both at the beginning of the dialogue and also after Quantitative and Qualitative Evaluation of Darpa Communicator Spoken Dialogue Systems Marilyn A. Walker AT& amp;T Labs – Research 180 ... dialogue parser, and retrain our models of user satisfaction. We ﬁnd that many of the dialogue act metrics are signiﬁcant predictors of user satisfaction, and...

Ngày tải lên : 31/03/2014, 04:20

8
319
0

báo cáo khoa học: "Phenotype and functional evaluation of ex vivo generated antigen-specific immune effector cells with potential for therapeutic applications" pps

... cross-pres- entation requires further investigation. To assess differentiation and maturation status of the ex vivo generated T cells, we applied multi-color flow cytom- etry to detect differentiation and ... proliferation and replicative senescence associ- ated with down-regulation of anti-apoptotic protein Bcl-2 and Bcl-xL, and decreased telomere length. [33,34,41] Modificatio...

Ngày tải lên : 10/08/2014, 22:20

16
215
0

báo cáo khoa học: "Profiling and quantitative evaluation of three Nickel-Coated magnetic matrices for purification of recombinant proteins: helpful hints for the optimized nanomagnetisable matrix preparation" pps

... purification of His-tagged proteins and presents a major lim- itation for broad application of such materials. I n this regard, optimization and evaluation of commercially available matrices is mandatory, ... conception and design. SZ has participated in data analysis and AHZ has involved in methodology design, interpretation of data, critical revision of the manuscript...

Ngày tải lên : 11/08/2014, 00:23

11
289
0

Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc

... the reconstitution of PrP–GPIm into liposomes. PrP–GPIm was mixed with the appropriate amount of OG and soni- cated for 15 min in a water bath at room temperature. Liposomes were added to yield ﬁnal concentrations ... involves the use of 70% (v ⁄ v) eth- anol in water, 10-fold molar excess of GPIm and incu- bation at room temperature for 2 h. The use of buffer (MES or MOPS)...

Ngày tải lên : 23/03/2014, 10:21

15
425
0

Báo cáo khoa học: Biochemical and molecular characterization of puriﬁed chicken pancreatic phospholipase A2 docx

... volume of 20 lL for 5 min at room temperature and 60 min at 42 °C. The cDNA–RNA heteroduplex was then denaturated at 70 °C for 15 min and cooled on ice. Cloning of the mature PLA 2 gene Ampliﬁcation ... compilation ª 2009 FEBS 35 cycles of denaturating at 94 °C for 1 min, primer anneal- ing at 55 °C for 1 min, and extension at 72 °C for 3 min. The PCR product (500 kbp)...

Ngày tải lên : 30/03/2014, 01:20

10
358
0

Báo cáo khoa học: " Managerial and environmental determinants of clinical mastitis in Danish dairy herd" doc

... interpretation of data and revising the manuscript. LA participated in the statistical design and analysis, and revising the manuscript. JFA and HH made substantial contribution to conception and revising ... estimate the association of management variables with herd mastitis rate. Results: Three latent factors (quality of labor, region of Denmark and claw trimming, and...

Ngày tải lên : 12/08/2014, 18:22

8
255
0

Báo cáo khoa học: " Biochemical and developmental characterization of carbonic anhydrase II from chicken erythrocytes" doc

... CA-II of approximately 15% above that of non-pregnant female Beagles and 30% above that of male Beagles [ 12]. Mean concentrations of CA-I and CA-II in racehorses were 1.70 and 0.94 mg/g of Hb, ... intracellular pH of the shell gland fell to a mean value of 6.53 during the first 8 h of calcification and then rose to 6.97 during the latter part of shell formation. The...

Ngày tải lên : 12/08/2014, 18:22

9
493
0

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE ... the presence and absence of ATP. In the presence of ATP, puriﬁed wild-type Vps4 is catalytically active and will hydrolyse added ATP. Thus interactions that are regulated by Vp...

Ngày tải lên : 23/03/2014, 09:20

14
362
0

Báo cáo khoa học: "Beyond Projectivity: Multilingual Evaluation of Constraints and Measures on Non-Projective Structures" doc

... we only provide counts of edges of positive, nonpositive, and negative level types. For lack of space, we do not present full distributions of level types nor of level signatures. Positive level ... level signatures of non-projective edges, combining lev- els of nodes with the partitioning of gaps of non- projective edges into components. We derive a for- mal property of...

Ngày tải lên : 23/03/2014, 18:20

8
334
0