Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot
Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot
... Central
Page 1 of 3
(page number not for citation purposes)
Journal of Medical Case Reports
Open Access
Case report
Direct spread of thyroid follicular carcinoma to the parotid gland
and the internal ... unusual metastasis of a thyroid follicular
carcinoma including the histopathological and radiological findings. A woman was seen in the
oto...
Báo cáo y học: " Early detection of Varicella-Zoster Virus (VZV)-specific T-cells before seroconversion in primary varicella infection: case report" potx
... immunocompetent
German (Caucasian) man who presented with skin rash
and fever (day 0). Due to the clinical appearance of a
typical “varicella-like” rash phenotype, antiviral therapy
with Brivudine was initiated ... initiate specific antiviral thera py. Serological
markers (i.e. VZV-IgM and/ or VZV-IgG) are not appro-
priate for the laboratory diagnosis of early varicella,
becau...
Báo cáo y học: " Bioprosthetic mitral valve thrombosis less than one year after replacement and an ablative MAZE procedure: a case report" ppsx
... management of patients with
valvular heart disease). Endorsed by the Society of Cardiovascular
Anesthesiologists, Society for Cardiovascular Angiography and
Interventions, and Society of Thoracic ... G,
Flachskampf F, Hall R, Iung B, Kasprzak J, Nataf P, Tornos P, Torracca L,
Wenink A, Guidelines on the management of valvular heart disease: The
Task Force on the Managemen...
Báo cáo y học: "Cerebral misery perfusion diagnosed using hypercapnic blood-oxygenation-level-dependent contrast functional magnetic resonance imaging: a case report" potx
... [5].
Case presentation
A 50-year-old Caucasian man was admitted with an acute
right hemiparesis, affecting his arm, leg and face, and a
right homonymous hemianopia. His vascular risk factors
included ... factors
included a 25 pack-year smoking history and a previous
myocardial infarction. An initial computed tomography
(CT) head scan and m agnetic resonance imaging (MRI)
sca...
Báo cáo y học: " Growth factor-enriched autologous plasma improves wound healing after surgical debridement in odontogenic necrotizing fasciitis: a case report" doc
... presentation: A 69-year old Mexican male had a pain in the maxillar right-canine region and a swelling of
the submental and submandibular regions. Our examination revealed local pain, tachycardia, ... tachycardia, and
hyperthermia (39°C). The bilateral submental and sub-
mandibular regions had a 10-cm diameter swelling and
well-delimitated erythematous, hyperthermia,...
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... by affecting both the growth-factor triggered
activation of fibroblasts and the accumulation of T
lymphocytes.
The significance of this research for understanding the
pathogenesis of RA (and potentially ... contribute directly to the
pathogenesis of synovial inflammation and joint
destruction has seen a ‘revival’ over the last couple of
years [6,7]. This is ma...
Báo cáo y học: "Direct sequencing of the human microbiome readily reveals community differences" pps
... distances.
In this analysis, PERMANOVA uses the UniFrac distances to compute a test statistic similar to an F-ratio, and then reports both the
signicance of the statistic and the portion of variation ... meta-
genomic data are so far available only from the gut and
for a relatively few samples, and so the range of questions
that can be addressed at prese...
Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx
... gene of the viral genome
whereas for the murine hybrid retrovirus primers T3R27s2
(CAGGGAGAACATGGTAATAGGA) and T3R2 7a2
(ACGACCTCTCCAAAGTATCCA) were used to amplify a
region within the env gene. As ... infected cells and the primers
SMRV-1s (GTTGGGAACCCAGGCTAAGCTG) and SMRV-
805 7a (GTAGGAGGGGAACCGGCTAC) for SMRV and
T3R03s (AGGGGATTTATTGGATACACG), T3R3 2a
(CATCGTGACC...
Báo cáo y học: " Rapid spread of mouse mammary tumor virus in cultured human breast cells" pot
...
A8
B8
E8
F8
H8
F7
G7
Mtv17 t t a t c
Mtv2 7201 aagtagataagcaagtatttctttctgatacacccacggttgataataataaacctgggggaaagggtgataaaaggcgtatgtgggaactttggttgactactttggggaactcagggg
F6
G6
H6
A7 ...
A7 a
B7
C7
D7 g c
E7
H7
A8
B8
E8
F8 a a a
H8
F7 c
G7
Mtv17 g a c g
Mtv2 7321 ccaatacaaaactggtccctataaaaaagaagttgccccccaaatatcctcactgccagatcgcctttaagaaggacgccttctgggagggagacga...
Từ khóa:
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật