Báo cáo y học: "Two-dimensional power Doppler-three-dimensional ultrasound imaging of a cesarean section dehiscence with utero-peritoneal fistula: a case report" pdf
Báo cáo y học: " laboratory driving simulation for assessment of driving behavior in adults with ADHD: a controlled study" docx
... information from the laboratory at M.I.T with the
data at the laboratory at Massachusetts general Hospital.
BR: Worked closely with all authors on the design and
analysis of the driving data.
JFC: ... full access to all of the data in the
study and takes responsibility for the integrity of the data and the accuracy
of the data analysis.
References
1. Faraone S, Biederman J, Mick...
Báo cáo y học: "vitamin B12 status in patients of Turkish and Dutch descent with depression: a comparative cross-sectional study" pot
... general physical examination was conducted to exclude
the possibility of a physical cause of the psychiatric illness.
A laboratory examination was also performed that cov-
ered electrolytes, hepatic ... and ratio
data with a normal distribution were tested with the par-
ametric Student t test. Interval and ratio data without a
normal distribution and data of an ordinal measu...
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... ATATTTATACGCCTTTTGATTCCT 297
GGTACCCGTAGAGCTTCCGTTCC
α
2
M GCCCGCTTTGCCCCTAACA 359
TCGTCCACCCCACCCTTGATG
RECK GTAATTGCCAAAAAGTGAAA 352
TAGGTGCATATAAACAAGAAGTA
ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264
CATCATGGGGCATGTTAAACAC
ADAMTS-4 ... 287
AATAGCTTTACGGGTTTCAGG
TIMP-1 TGGGCACCTGCACATCACC 277
CATCTGGGCCCGCAAGGACTG
TIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277
TGTCCCAGGGCACGATGAAGTC
TIMP-3 GATGTACCGAGGATTCACCA...
Báo cáo y học: "Dietary Use and Conservation Concern of Edible Wetland Plants at Indo-Burma Hotspot: A Case Study from Northeast India" doc
... states of India (namely Arunachal
Pradesh, Assam, Meghalaya, Manipur, Mizoram, Naga-
land, and Tripura) form an integral part of the Indo-
Burma centre of biodiversity hotspot of global signifi-
cance ... 8
Nymphaea nouchali Tharo-angangba 2 2 2 2 8
Nymphaea pubescens Tharo-ashangba 2 2 2 2 8
Nymphaea stellata Thariktha 2 2 2 2 8
Nymphoides indica Thariktha-macha 2 2 2 2 8
Oenanthe ja...
Báo cáo y học: "Pulmonary stenosis development and reduction of pulmonary arterial hypertension in atrioventricular septal defect: a case report" pdf
... ventricular systolic pressure
was 85 mmHg and pulmonary artery (PA) systolic pres-
sure almost systemic at 75 mmHg with pulmonary to sys-
temic vascular resistance ratio of 0,3, and pulmonary-
systemic ... 2006 and 2008.
They highlighted a late and progressive development of a valvular and infundibular pulmonary
stenosis leading to a normalisation of pulmonary arterial pressures...
Báo cáo y học: " Atypical right diaphragmatic hernia (hernia of Morgagni), spigelian hernia and epigastric hernia in a patient with Williams syndrome: a case report" ppsx
... epigastric hernia in a patient with Williams syndrome: a
case report
Farhan Rashid*
1
, Ramakrishna Chaparala
2
, Javed Ahmed
2
and
Syed Y Iftikhar
2
Address:
1
Division of GI Surgery, Clinical ... show any abnormality in a
patient with intermittent herniation. CT is the modality of
choice for diagnosis of Morgagni's hernia and diagnosis
may be established by the p...
Báo cáo y học: "Marked disability and high use of nonsteroidal antiinflammatory drugs associated with knee osteoarthritis in rural China: a cross-sectional population-based survey" ppt
... the heavy physical demands of
farming o r timely availability of knee-replacement sur-
gery may be cost-effective measures to reduce this bur-
denofpainanddisabilityandpossible NSAIDs-related
comorbidity.
Abbreviations
BMI: ... engaged in heavy occupational physical activity throughout their life span. The aim of this survey
was to estimate the burden of disability, analgesia, and hea...
Báo cáo y học: "The association between microvascular and macrovascular endothelial function in patients with rheumatoid arthritis: a cross-sectional study" pdf
... Yeung AC: Close relation of
endothelial function in the human coronary and peripheral circulations.
J Am Coll Cardiol 1995, 26:1235-1241.
10. Takase B, Hamabe A, Satomura K, Akima T, Uehata A, ... endothelial-independent (glyceryl trinitrate-mediated dilation) macrovascular vasodilatory function.
Vasodilatory function was calculated as the percentage increase after each stimulus was appli...
Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc
... Isola-
tion of a new type C retrovirus (HTLV) in primary uncul-
tured cells of a patient with Sézary T-cell leukaemia. Nature
1981, 294:268-271.
5. Kalyanaraman VS, Sarngadharan MG, Robert-Guroff ... Miyoshi I, Hatakeyama N, Murakami K, Sawada T, Takimoto Y:
Sézary syndrome in an HTLV-I-seronegative, genome-posi-
tive Japanese. Am J Hematol 1998, 57:184-185.
28. Ellerbrok H, Fleis...
Báo cáo y học: "Filter survival time and requirement of blood products in patients with severe sepsis receiving drotrecogin alfa (activated) and requiring renal replacement therapy" pptx
... received a
full course of DrotAA and a minimum of eight days of RRT.
Patients' demographic information, markers of disease sever-
ity, biochemical and haematological data, details of anticoagu-
lation ... alfa (activated) (DrotAA) in addition to the indicated anticoagulation
during the DrotAA period. When no additional anticoagulation was administered filters were anticoag...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- cáo cáo y học
- ứng dụng công nghệ tế bào trong y học
- ứng dụng của công nghệ tế bào trong y học
- ứng dụng di truyền học tế bào trong y học
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật