báo cáo khoa học: " Social structural factors that shape ass

báo cáo khoa học: " Social structural factors that shape assisted injecting practices among injection drug users in Vancouver, Canada: a qualitative study" pps

... RESEA R C H Open Access Social structural factors that shape assisted injecting practices among injection drug users in Vancouver, Canada: a qualitative study Nadia Fairbairn 1 , Will Small 1 , ... severe harms that arise from assisted injecting. Social structural factors that shape the risks related to assisted injection in the Vancouver...

Ngày tải lên : 11/08/2014, 18:20

7
260
0

báo cáo khoa học: " Seroprevalence of HIV, hepatitis b, and hepatitis c among opioid drug users on methadone treatment in the netherlands" ppt

... (33%) had an tibodies against HBV (anti-HBc). In total 1469 ODUs were vaccinated against HBV between 2002 and 2008, ei ther full or partially. The esti- mated vaccination coverage among ODUs in Amster- dam ... of importance to raise awareness about HCV and facilitate its early diagnosis among incarcerated drug users and others outside the methadone setting. Harm reduction interven...

Ngày tải lên : 11/08/2014, 18:20

7
340
0

báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc

... needle/syringe sharing behaviours A variety of contextual factors emerged in the qualitative data that helped to illuminate needle/syringe sharing practices among HIV-positive IDUs. Fear of harassment ... data collection and data analysis. RD participated in data analysis, drafting and revision of the manuscript. All authors participated in the design of the study, and rea...

Ngày tải lên : 11/08/2014, 18:20

10
272
0

báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

... Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino K, Hige S, Ito Y, Mita E, Tanaka E, Mochida S, Murawaki Y, Honda M, Sakai A, Hiasa Y, Nishiguchi S, Koike A, Sakaida I, Imamura M, Ito K, Yano ... Honda M, Sakai A, Yamashita T, Nakamoto Y, Mizukoshi E, Sakai Y, Yamashita T, Nakamura M, Shirasaki T, Horimoto K, Tanaka Y, Tokunaga K, Mizokami M, Kaneko S: Hepatic ISG Expression Is Associ...

Ngày tải lên : 11/08/2014, 12:21

13
401
0

Báo cáo y học: "The influence of behavioural and health problems on alcohol and drug use in late adolescence - a follow up study of 2 399 young Norwegians" pptx

... often. Factor analyses revealed two factors with eigenval ue >1. “ Having trouble concentrating in class” and “Can not manage to be calm in class ” indicat- ing attention problems, and “ Arguing ... 5:17 http://www.capmh.com/content/5/1/17 Page 7 of 9 Introduction European adolescents have increased their alcohol and drug intake during the last decades; in particular binge drinki...

Ngày tải lên : 13/08/2014, 18:21

9
343
0

Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc

... with dynamic information from heteronuclear NOEs and structural insight from homonuclear NOE-based distance constraints indicated that micelle-associated VpUcyt retains a substantial degree of structural ... micelle-associated VpUcyt was calculated on the basis of the ﬁnal set of proton–proton distance constraints using cyana, a software program that combines simulated annea...

Ngày tải lên : 18/02/2014, 06:20

16
632
0

Tài liệu Báo cáo khoa học: "Using Structural Information for Identifying Similar Chinese Characters" pdf

... combinations of character pairs. The Ministry of Education in Taiwan suggests that about 5000 characters are needed for ordinary usage. In this case, there are about 25 million pairs. The quantity ... “visually similar” characters for characters that appeared in Figure 2 and Figure 3. For instance, we can tell that “搞” and “篙” are similar because their Cangjie codes sha...

Ngày tải lên : 20/02/2014, 09:20

4
415
0

Báo cáo khoa học: Conserved structural determinants in three-ﬁngered protein domains pdf

... following way: the distances between a- carbon atoms in cystines A and B were calculated, namely CA a1 CB a1 , CA a2 CB a1 ,CA a1 CB a2 and CA a2 CB a2 , where CA a1 is the a- carbon of the N-terminal ... listed in Table 1. The optimal alignment of half-cystines was obtained by intro- ducing a few gaps manually. The amino acids in the b-sheet and a- helical stru...

Ngày tải lên : 07/03/2014, 06:20

19
401
0

Báo cáo khoa học: The sigma factors of Mycobacterium tuberculosis: regulation of the regulators potx

... trans- membrane protein, with an extracellular C-terminal domain, possibly involved in sensing an in vivo stimulus for the release of r K and an intracellular N-terminal domain involved in interaction ... phosphory- lation of the kinase–substrate fusion protein in an intra- molecular reaction. The anti-r factor domain activates the phosphatase domain through direct interaction, while...

Ngày tải lên : 15/03/2014, 09:20

22
347
0

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

... thermoaerophilus were ampliﬁed from chromosomal DNA templates, using the following primer pairs: P. aeruginosa,5¢-AGGCCCGCTTC C GGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢; and A. thermoaerophilus,5¢-TT GGATCCATGAGAGCCCTAATCACTG GA-3¢ ... Comparison of the active sites and amino acid sequences suggests that a conserved amino acid side chain (Arg185 in P. aerugi...

Ngày tải lên : 16/03/2014, 01:20

15
402
0