Báo cáo y học: " Abnormal macrophage response to microbial s

Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

... 24:2227-2236. doi:10.1186/1752-1947-4-183 Cite this article as: Conti et al.: Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report. Journal of Medical Case Reports ... 43-year-old man with a severe form of atherosclerosis: a case report Maria Conti 1 , Francesca...

Ngày tải lên : 11/08/2014, 12:20

5
409
0

Báo cáo y học: " Predictors and correlates for weight changes in patients co-treated with olanzapine and weight mitigating agents; a post-hoc analysis" docx

... risk of weight gain. A meta-analysis by Allison and colleagues showed a significantly greater incidence of weight gain in patients treated with clozapine or olanzapine compared with patients ... just initiated on olanzapine treatment. Finally, we cannot exclude the possibility that nizatidine is less effective than amantadine or sibutramine as a weight-mitigating agent. Sinc...

Ngày tải lên : 11/08/2014, 16:23

11
497
0

Báo cáo y học: "Correction: Clinical response to discontinuation of anti-TNF therapy in patients with ankylosing spondylitis after 3 years of continuous treatment with infliximab" ppt

Ngày tải lên : 09/08/2014, 06:23

1
377
0

Báo cáo y học: "Specific IgE response to purified and recombinant allergens in latex allergy" pptx

... latex allergy [3,5]. Among the 21 SB patients studied, 13 had clinical latex allergy [11]. Latex allergy in health care workers was diagnosed by (a) a history of skin and respiratory symptoms ... demonstration of antibody to latex antigens and a history of cross-reaction to food allergens [11]. All sera were evaluated for latex specific IgE antibody using a Malaysian non-a...

Ngày tải lên : 13/08/2014, 13:22

9
388
0

Báo cáo y học: "Genomic transcriptional response to loss of chromosomal supercoiling in Escherichia coli" doc

... to those 13 arrays only. Additional data files The following additional data files are available with the online version of this paper: Additional data file 1 contains data on the induction of ... of our data (21 arrays measuring responses to DNA relaxation, and 14 con- trol arrays with negatively supercoiled DNA) minimized the influence of any single array measurement. Thus w...

Ngày tải lên : 14/08/2014, 14:21

16
289
0

Báo cáo y học: "Polarized monocyte response to cytokine stimulation" pps

... TGGATCCAAAACTACTCGGAAGA MMP9 r: GAAGGCGCGGGCAAA MMP9 p: FAM-CGCGGGCGGTGATTGACGAC-TAMRA MMP19 f: GACGAGCTAGCCCGAACTGA MMP19 r: TTTGGCACTCCCGTAAACAAA MMP19 p: FAM-TCAGCAGCTACCCCAAACCAATCAAGG- TAMRA Mannose ... inflammation [27]. Validation of microarray analysis by TaqMan real-time PCR To define the validity and accuracy of our global microarray analysis, quantitative TaqMan real-time PC...

Ngày tải lên : 14/08/2014, 14:21

16
233
0

Báo cáo y học: "The genomic response to 20-hydroxyecdysone at the onset of Drosophila metamorphosis" ppsx

... separately for microarray analysis. Microarray and cluster analysis All experiments for microarray analysis were performed inde- pendently, in triplicate, to facilitate statistical analysis. Total RNA ... generated by PCR from genomic DNA using the following pairs of primers: hairy forward (F), 5'CAAATTGGAAAAGGCCGACA3'; hairy reverse (R), 5'AGAGAAACCCTAAGCGGCTT3'; ca...

Ngày tải lên : 14/08/2014, 15:20

13
306
0

Báo cáo y học: "Maternal Outcomes According to Placental Position in Placental Previa"

... 11. Ogawa M, Sato A, Yasuda K, et al. Cesarean section by transfundal approach for placenta previa percreta attached to anterior uterine wall in a woman with a previous repeat cesarean section: ... associated with peripartum cesarean hysterectomy in women with placenta previa. Am J Perinatol. 2008; 25:37-41. 7. Bahar A, Abusham A, Eskandar M, et al. Risk factors and...

Ngày tải lên : 25/10/2012, 10:56

6
503
0

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

... [2,3]. The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a contributing factor to many diseases. Decreased autophagy may promote the development of ... steady-state autophagy without a corresponding increase in cumulative autophagy would indicate a defect in autophagosome clear- ance (a failure to route autophagosome...

Ngày tải lên : 07/03/2014, 09:20

14
444
0

Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx

... Tokunaga M, Saito K, Kawabata D, Imura Y, Fujii T, Nakayamada S, Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y: Efficacy of rituximab (anti-CD20) for refractory systemic lupus erythematosus ... down-regu- lation of the T cell costimulatory molecule CD40 ligand: an open-label trial. Arthritis Rheum 2005, 52:501-513. 30. Tokunaga M, Fujii K, Saito K, Nakayamada S, Tsujimura...

Ngày tải lên : 09/08/2014, 14:22

8
376
0