Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...
Ngày tải lên : 08/08/2014, 18:20
  • 14
  • 350
  • 0
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

... W, 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; for E318 to Y, 5¢-CAATGTGTCTGATTATGCA GCTCTACTAGAAAAG-3¢. ... : a case con trol study. Lancet 353, 351–353. 20. Matsubara, Y. , Mur ata, M., Maruyama, T., Handa, M., Yamagata, N ., Watanabe, G ., Saruta, T. & Ikeda, Y....
Ngày tải lên : 08/03/2014, 22:20
  • 9
  • 471
  • 0
Báo cáo y học: "A novel hybrid aspirin-NO-releasing compound inhibits TNFalpha release from LPS-activated human monocytes and macrophages" docx

Báo cáo y học: "A novel hybrid aspirin-NO-releasing compound inhibits TNFalpha release from LPS-activated human monocytes and macrophages" docx

... (3-carbamoyl- furoxan-4-yl)methyl 2-acetoxybenzoate (B7), their respective NO-free counterparts (furazans), (4-cyanofura- zan-3-yl)methyl 2-(acetoxy)benzoate (B16) and (4-car- bamoylfurazan-3-yl)methyl ... release from LPS-activated human monocytes and macrophages Catriona M Turnbull 1 , Paolo Marcarino 2 , Tara A Sheldrake 4 , Loretta Lazzarato 2 , Clara Cena 2 , Roberta Fruttero 2 , A...
Ngày tải lên : 11/08/2014, 08:22
  • 10
  • 365
  • 1
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a ... the Japanese. Circ Res. 2000; 86: 841-5. 13. Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K. Isolation of the 5'-flanking region of genes by thermal asymmet- ric inte...
Ngày tải lên : 26/10/2012, 10:04
  • 7
  • 612
  • 1
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan. The gene encoding 4-amino-3-hydrox- ybenzoate 2,3-dioxygenase is currently being ... 6-amino-m-cresol and 2,5- pyridinedicarboxylic acid were purchased from Tokyo Kasei Kogyo (Tokyo, Japan), meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan) and 4...
Ngày tải lên : 21/02/2014, 01:21
  • 7
  • 490
  • 0
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx

Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx

... the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No other enzyme has been reported to catalyse ... and average spore size did not change during induction. Stability of citral lyase activity The activity and stability of citral lyase was dramatically affected by the addition of 20% (v/...
Ngày tải lên : 21/02/2014, 01:21
  • 8
  • 575
  • 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... transillumination. Statistical analysis Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ±SEM. ... 83:1174- 1178. 19. Kasama T, Shiozawa F, Kobayashi K, Yajima N, Hanyuda M, Takeuchi TT, Mori Y, Negishi M, Ide H, Adachi M: Vascular endothelial growth factor expression by activ...
Ngày tải lên : 09/08/2014, 01:21
  • 8
  • 446
  • 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAG...
Ngày tải lên : 09/08/2014, 07:20
  • 9
  • 559
  • 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

... metalloproteinase 9 (96-kd gelatinase B) in human rheumatoid arthritis. Arthritis Rheum 1996, 39:1576-1587. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... fluorescent substrate on microspheres. Cytometry 1996, 25:374-380. 17. Kitano T, Ohashi H, Kadoya Y, Kobayashi A, Yutani Y, Yamano Y: Measurement of ζ potentials of p...
Ngày tải lên : 09/08/2014, 08:22
  • 10
  • 494
  • 0
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

... in a 76-year-old man with a coarctation of the aorta. Cardiology 1999, 92:284-286. 8. Bauer M, Alexi-Meskishvili V, Bauer U. Benefits of surgical repair of coarctation of the aorta in patients ... York: McGraw Hill Professional; 2004:1866. 4. Campbell M. Natural history of coarctation of the aorta. Br Heart J 1970, 32:633-640. 5. Jenkins NP, Ward AR. Coarctation of th...
Ngày tải lên : 25/10/2012, 11:40
  • 2
  • 487
  • 0

Xem thêm

Từ khóa: