Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation " pot

Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

... LundqvistEfficient wood and fiber characterization Original article Efficient wood and fiber characterization – A key factor in research and operation Sven-Olof Lundqvist * STFI, Swedish Pulp and Paper Research ... char - acterization and modeling, as well as experiments in the laboratory, in a pilot plant and in mills. Many properties of woo...
Ngày tải lên : 08/08/2014, 14:20
  • 12
  • 229
  • 0
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

... mitogen-activated protein ⁄ extracellular signal-regulated kinase kinase ⁄ extracellular signal- regulated kinase and nuclear factor kappaB pathway and cellular transformation. Cancer Res 64, 342 8– 3435. 50 ... results indicate that Ca 2+ in ux via the L-type channel and an increase in intracellular Ca 2+ levels are involved in the action of neokyotorphin in L929 fibroblasts...
Ngày tải lên : 07/03/2014, 11:20
  • 11
  • 726
  • 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

... CGGGACGGTGTTGAGAGTGGA CXCL12.rv5 GAGAGTGGACCGGCACCAACA qCXCL12b.fw1 GAGGAGGACCACCATGCATCT qCXCL12b.rv1 TTGTGCAAGCAGTCCAGAAAGA Carp CXCL14 AJ536028 CXCL14.rv3 GGATGCAGGCAATACTCCTG CXCL14.fw5 CCATACTGCCAAGAAAAGATGAT qCXCL14.fw1 ... CAACAGGGAAAAGATGACACAGATC qACT.rv1 GGGACAGCACAGCCTGGAT Vector T7 TAATACGACTCACTATAGGG T3 CGCAATTAACCCTCACTAAAG Ó FEBS 2004 Three novel carp CXC chemokines (Eur. J. B...
Ngày tải lên : 16/03/2014, 18:20
  • 13
  • 398
  • 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

... H., Hata, N ., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N. & Taniguchi, T. (2000) Distinct and essential roles of transcription factors IRF-3 and ... transfection. CAT and b-galactosidase activities were measured in extracts of transfected cells [24], and CAT activity was expressed in arbitrary units after normalization to b-galactos...
Ngày tải lên : 23/03/2014, 13:20
  • 11
  • 487
  • 0
Báo cáo khoa học: High-resolution crystal structures of the flavoprotein NrdI in oxidized and reduced states – an unusual flavodoxin pot

Báo cáo khoa học: High-resolution crystal structures of the flavoprotein NrdI in oxidized and reduced states – an unusual flavodoxin pot

... with apoflavodoxin: a sensitive assay for riboflavin 5¢-phosphate and flavin adenine dinucleotide in mix- tures. Anal Biochem 68, 60 9–6 16. R. Johansson et al. NrdI – an unusual flavodoxin FEBS Journal ... CONSOLIDER (CSD2008-00013) and ERANET Pathogenomics.We wish to thank Maria Ha ˚ kansson for help at the MAX- lab crystallization facility and the staff at beamline I911 at MAX-...
Ngày tải lên : 29/03/2014, 21:20
  • 13
  • 422
  • 0
Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

... Switzerland. Authors’ contributions MS and AF coordinated the entire study. Patient accrual and clinical data collection was done by MS, SC, CB, MB, PN, SP. Data analysis, physics data and treatment ... data of Group A and B were analyzed together; presenting irradiation of similar anatomical regions, while Group C was kept separated involving the sinonasal region only, and not th...
Ngày tải lên : 09/08/2014, 09:20
  • 10
  • 380
  • 0
Báo cáo khoa học: "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo" docx

Báo cáo khoa học: "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo" docx

... were purchased from Harlan Laboratories, Inc. (Indianapolis, Indiana). Animals were kept and handled under a 12h/12h light/dark cycle at 22°C, received a standard diet and acidified water. Mice ... Guangzhou, China. 6 Department of Radiology and Radiation Oncology, Kitasato University School of Medicine, Sagamihara, Kanagawa, Japan. 7 Cancer Hospital, Chinese Academy of Medical Scie...
Ngày tải lên : 09/08/2014, 09:20
  • 8
  • 306
  • 0
Tài liệu Báo cáo khoa học: "Generalized Hebbian Algorithm for Incremental Singular Value Decomposition in Natural Language Processing" potx

Tài liệu Báo cáo khoa học: "Generalized Hebbian Algorithm for Incremental Singular Value Decomposition in Natural Language Processing" potx

... the dataset makes conventional batch approaches infeasible. It is also of interest in the context of adaptivity, since it has the po- tential to adapt to changing input. The learn- ing update operation ... eigenvectors of A ∗ A T and A T ∗ A, r espectively, and the singular values, Σ, are the square-roots of the corresponding eigenvalues. 2.1 Generalised Hebbian Algorithm Oja...
Ngày tải lên : 22/02/2014, 02:20
  • 8
  • 362
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... for inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and ... muscle remodelling in skeletal muscle. Abbreviations AAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI, 4¢,6-...
Ngày tải lên : 07/03/2014, 03:20
  • 16
  • 428
  • 0
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... kDa. Each PKG monomer harbors several different functional domains associated with their respective N-terminal, regulatory and C-terminal, catalytic subdomains. The regulatory domain contains a ... the intensity increased between 0 and 4 m urea and later decreased again between 4 and 8 m urea. A clear shift in maximal emis- sion wavelength (MEW) between the native and the full...
Ngày tải lên : 07/03/2014, 09:20
  • 13
  • 440
  • 0

Xem thêm

Từ khóa: