báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

... http://www.translational-medicine.com/content/7/1/ 52 Page 3 of 4 (page number not for citation purposes) Statistical analysis Data are expressed as mean ± standard deviation (SD) or as number and percentage where appropriated. Statistical analysis ... linking between FVL gene variant, diabetes and atherothrombosis and other vascular complications, although data on larger population...
Ngày tải lên : 18/06/2014, 15:20
  • 4
  • 594
  • 0
Báo cáo hóa học: " Gait training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study" ppt

Báo cáo hóa học: " Gait training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study" ppt

... under each eva- luation were averaged for each participant. A one-way analysis of variance (ANOVA) was conducted, using evaluation (before and after gait training) as a factor and mean walking ... training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study Catarina O Sousa 1 , José A Barela...
Ngày tải lên : 19/06/2014, 08:20
  • 8
  • 284
  • 1
báo cáo hóa học: " Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim Mutter" pdf

báo cáo hóa học: " Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim Mutter" pdf

... 6:2 http://www.occup-med.com/content/6/1/2 Page 2 of 17 REVIEW Open Access Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim Mutter Abstract It was claimed by the Scientific Committee ... 11:331-337. doi:10.1186/1745-6673-6-2 Cite this article as: Mutter: Is dental amalgam safe for...
Ngày tải lên : 20/06/2014, 00:20
  • 17
  • 454
  • 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850 , respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823 ; AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGG...
Ngày tải lên : 20/06/2014, 01:20
  • 11
  • 854
  • 0
báo cáo hóa học:" Is there added risk in resurfacing a femoral head with cysts?" ppt

báo cáo hóa học:" Is there added risk in resurfacing a femoral head with cysts?" ppt

... femoral head with cysts? Thomas P Gross and Fei Liu * Abstract Background: Femoral head cysts have been identified as a risk factor for early femoral failures after metal-on-metal hip resurfacing arthroplasty ... recommend that the presence of cysts within the femoral head, as long as they comprise less tha n 1/3 of the remaining prepared femoral head, be eliminated as...
Ngày tải lên : 20/06/2014, 07:20
  • 7
  • 505
  • 0
báo cáo hóa học:" Benefits of an educational program for journalists on media coverage of HIV/AIDS in developing countries" docx

báo cáo hóa học:" Benefits of an educational program for journalists on media coverage of HIV/AIDS in developing countries" docx

... number not for citation purposes) Journal of the International AIDS Society Open Access Research Benefits of an educational program for journalists on media coverage of HIV/AIDS in developing countries Jorge ... respectively, per month in the time since the conference. Radio and newspaper cov- erage are the most likely means for dissemination of infor- m...
Ngày tải lên : 20/06/2014, 08:20
  • 10
  • 447
  • 0
báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

... Congo Equatorial Guinea Eritrea Gabon Gambia Ghana Guinea Guinea-Bissau Lesotho Liberia Madagascar Malawi Mali Mauritania Mauritius Niger Sao Tome and Principe Senegal Seychelles Sierra Leone Swaziland Togo Zimbabwe Fraction ... such as infant mortality and all cause mortal- ity" [24]. The purpose of this study is to assess the association between PEPFAR funding and chang...
Ngày tải lên : 20/06/2014, 08:20
  • 9
  • 342
  • 0
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

... 23:5 http://www.enveurope.com/content/23/1/5 Page 7 of 9 COMM E N TAR Y Open Access REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries) Ivana Teodorović * , ... description of the FP 6 funded REP LECOTOX project and the profile of LECOTOX research team. Authors’ contributions IT...
Ngày tải lên : 21/06/2014, 06:20
  • 9
  • 374
  • 0
báo cáo hóa học:" Review Article An Overview of the Lower and Upper Solutions Method with Nonlinear Boundary Value Conditions" doc

báo cáo hóa học:" Review Article An Overview of the Lower and Upper Solutions Method with Nonlinear Boundary Value Conditions" doc

... Elsevier/North-Holland, Amsterdam, The Netherlands, 2004. 14 C. De Coster and P. Habets, An overview of the method of lower and upper solutions for ODEs,” in Nonlinear Analysis and Its Applications to ... books of Bernfeld and Lakshmikantham 6 and Ladde et al. 7 the classical theory of the method of lower and upper solutions and the...
Ngày tải lên : 21/06/2014, 11:20
  • 18
  • 393
  • 0
Báo cáo hóa học: " Research Article An Adaptive Channel Interpolator Based on Kalman Filter for LTE Uplink in High Doppler Spread Environments" docx

Báo cáo hóa học: " Research Article An Adaptive Channel Interpolator Based on Kalman Filter for LTE Uplink in High Doppler Spread Environments" docx

... jointly by Kalman filter in time domain during training symbols. Since channel tap information is missing between the training symbols of two consecutive slots within a single subframe, an interpolation operation ... Kalman Filter for LTE Uplink in High Doppler S pre ad Environments Bahattin Karakaya, 1 H ¨ usey in Arslan, 2 and Hakan A. C¸ırpan 1 1 Department of Elec...
Ngày tải lên : 21/06/2014, 22:20
  • 10
  • 376
  • 0
Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx

Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx

... propose an elegant addressing scheme and its routing algorithm. While maintaining the existing address scheme, it tackles the wastage problem and achieves no additional memory storage during a routing. ... 16 bits and is partitioned equally, every dimension will have the range of 0 and 255. Similarly, two address dimensions may be arbitrarily allocated—say, 10 bits for...
Ngày tải lên : 21/06/2014, 23:20
  • 13
  • 366
  • 0
Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

... Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function Samir Saoudi, 1, 2 Molka Troudi, 3 and Faouzi Ghorbel 4 1 Institut ... using only 3000 samples, gives a value of the BER with an error of 0.2dB. 7. Conclusions In this paper, we have suggested a new iterative soft b...
Ngày tải lên : 21/06/2014, 23:20
  • 9
  • 340
  • 0
báo cáo khoa học: "Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma?" pptx

báo cáo khoa học: "Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma?" pptx

... (hematoxylin eosin stain, 100 ×). Figure 1 1 Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma? Yassir ... be made available soon. Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive...
Ngày tải lên : 09/08/2014, 02:21
  • 18
  • 332
  • 0
Báo cáo y học: "Is there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection" ppt

Báo cáo y học: "Is there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection" ppt

... there was an Commentary Is there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection? Commentary on the meta-analysis ... Sweeting MJ, Buchan I, Matteson EL, Montori V: Anti-TNF antibody therapy in rheumatoid arthritis and the risk of serious infections and...
Ngày tải lên : 09/08/2014, 08:22
  • 3
  • 360
  • 0
Báo cáo y học: "Is there an optimal minimally invasive technique for left anterior descending coronary artery bypas" pdf

Báo cáo y học: "Is there an optimal minimally invasive technique for left anterior descending coronary artery bypas" pdf

... Port-Access coronary artery bypass grafting; MIDCAB, minimally invasive direct coronary artery bypass grafting; TECAB, totally endoscopic coronary artery bypass grafting; CCSC, Canadian Cardiovascular ... the surgical technique performed. PA-CABG, Port-Access coronary artery bypass grafting; MIDCAB, minimally invasive direct coronary artery bypass grafting; TECAB...
Ngày tải lên : 10/08/2014, 09:21
  • 6
  • 483
  • 0

Xem thêm

Từ khóa: