Báo cáo hóa học: " A comparative analysis of viral matrix proteins using disorder predictors" docx

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... Publisher. All rights reserved Research paper A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections ... commercially available PG and TA 3.6 Correlation coefficients We analyzed the correlation of levels of anti- peptidoglycan and teichoic acid antibodies in sera from pat...
Ngày tải lên : 02/11/2012, 11:08
  • 8
  • 524
  • 2
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... phase contrast and fluorescence photo- graphs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... prepared as described above for flow cytometry. After establishing a scan area, the slides were analyzed using a 40 · objective and 5 mW of Argon laser power. The entire cell...
Ngày tải lên : 20/02/2014, 23:20
  • 7
  • 581
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan). Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis sys- tem (Agilent Technologies, ... This analysis of microarray data revealed a striking similar- ity of gene clusters among AT-MSC-Hepa, primary hepatocytes and human liver. This indicates that AT-MSC-He...
Ngày tải lên : 30/03/2014, 04:20
  • 14
  • 597
  • 0
báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx

báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx

... Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory that travelled twice as far as needed would have a HPR of 2. Subsequently, ... effects of therapy for rehabilitation practice is important both for rehabilitation personal and patients. Characterizing the features of reaching and quantifying specifi...
Ngày tải lên : 19/06/2014, 10:20
  • 8
  • 551
  • 0
báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx

báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx

... for all features were also calculated with ROC areas. All data analyses were performed off-line, using custom software programs written for MATLAB (The Mathworks, Natick, MA). Surrogate data analysis To ... investigated in a larger and more diverse sample of healthy and falls risk elderly adults. Surrogate data analysis The use of surrogate data was aimed at destroying the underly...
Ngày tải lên : 19/06/2014, 10:20
  • 10
  • 471
  • 0
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... E-Mail: kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese ... zone, values of statistical measures such as type-token ratio, the parameters of 'laws' (e.g. of Mandel- brot, 1962) of word frequency distributions, etc. change s...
Ngày tải lên : 20/02/2014, 18:20
  • 7
  • 593
  • 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao * , Galen Andrew * , Mark Johnson *& , Kristina Toutanova * * Microsoft ... Introduction Parameter estimation is fundamental to many sta- tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generat...
Ngày tải lên : 08/03/2014, 02:21
  • 8
  • 504
  • 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... eztend/retraet can be analyzed as a modifier of cycle, a process word. Fuze setter, a part name, can be treated as a unit because noun sequences consisting of part names are generally local in nature. ... ). In addition, it can be a repair action (alignment, repair), an assistance actions ( assistance ), and so on. Only modifiers with appropriate semantic and syntactic ca...
Ngày tải lên : 08/03/2014, 18:20
  • 4
  • 515
  • 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E) PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in...
Ngày tải lên : 16/03/2014, 03:20
  • 14
  • 477
  • 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong...
Ngày tải lên : 17/03/2014, 01:20
  • 8
  • 546
  • 1

Xem thêm

Từ khóa: