Báo cáo hóa học: " Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection at a crossroads of intercontinental flyways" potx
Báo cáo hóa học: " Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection at a crossroads of intercontinental flyways" potx
... CentralPage 1 of 10(page number not for citation purposes)Virology JournalOpen AccessResearch Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection ... prevalence in surface-feeding ducks(Anatidae, tribe Anatini, 7.0%), followed by seabirdsGeographical location of sampling sites in Alaska in 2006 and 2007Figure 1Geographical location of sampling ... and Wildlife Service, Anchorage, Alaska, USA, 4US Department of Agriculture, National Veterinary Services Laboratory, Ames, Iowa, USA and 5Alaska Department of Fish and Game, Anchorage, Alaska,...
- 10
- 431
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... Brownstein Z, Marlin S,Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E,Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D,Dahl HH, Estivill X, Gasparini ... possiblehead or brain injury, and the use of aminoglycoside anti-biotics. All subjects showed moderate to profound bilat-eral sensorineural hearing impairment on audiograms.Careful medical examinations ... normal hearing using a com-mercially available DNA extraction kit (Watson Bio-technologies Inc., Shanghai, China).Mutational analysisThe coding exon (exon 2) and flanking intronic regions of GJB2...
- 7
- 695
- 0
báo cáo hóa học: " Prevalence of latent tuberculosis infection among health care workers in a hospital for pulmonary diseases" pptx
... data. Hehas been involved in drafting the manuscriptAS has made substantial contributions to conception anddesign, acquisition of data, as well as to analysis and inter-pretation of data. ... quality. Because of the inadequate data, it is difficult to evaluate the tubercu-losis risk in different medical specialties. The results arecontradictory and all in all do not indicate an increasedinfection ... statement can be made regarding the occupational risk ascompared to the general population because there are no LTBI prevalence data from Germanyavailable. The higher LTBI prevalence rate in older HCWs...
- 7
- 485
- 0
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... is translated.Stability of polymerase-template interactions at elevated temperatureGiven our observations of heat stable transcriptionallyactive polymerase and near normal accumulation of plus-sense ... suggesting that repli-cation of influenza virus is regulated by stabilization of repli-cative intermediates. J Virol 2004, 78:9568-9572.22. Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can ... temperatures (Fig. 2A lanes 1–3 and 7–9), indicating that the recombinant RNPs were active forboth transcription and replication. However, it was clearthat as the incubation temperature increased...
- 16
- 313
- 0
báo cáo hóa học:" Prevalence of Helicobacter pylori in HIV-infected, HAART-naïve Ugandan children: a hospital-based survey" ppt
... living in the area of Mulago Hill and, at thesame time, the role of a national referral hospital forUganda. Participants were enrolled from the generalpaediatric medical wards, the acute care ... [http://www.aidsuganda.org].3. Sharpstone D, Gazzard B: Gastrointestinal manifestations of HIV infection.Lancet 1996, 348:379-383.4. Wallace MR, Brann OS: Gastrointestinal manifestations of HIV infection.Curr ... comparison and anynon-matching data were checked manually against the ori-ginal paper form. The data were exported to SPSS version17.0 for statistical analysis. To explore the prevalence of H....
- 9
- 401
- 0
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt
... crucial to obtainnationwide estimates of low vision and blindness preva-lence rates so that sufficient resources are allocated appro-priately (medical and non-medical), especially whenincreasing ... AccessResearch Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approachAntoine J Lafuma1, Antoine P Brézin2, Francis L Fagnani1, Mounir ... the International Statistical Classification of Diseases, Injuries and Causes of Death, visual impairmentincludes both low vision and blindness. Low vision isdefined as visual acuity less than...
- 8
- 445
- 0
báo cáo hóa học: " Prevalence of multiple chronic conditions in the United States'''' Medicare population" pot
... prostate cancer - with a median age fordiagnosis at 68 years [9]. Cancer is the leading cause of death among people 60-79 years of age. In 2006 it wasestimated that COPD affected approximately ... determine whether there wasan indication of receiving evaluation of or treatment forthe condition of interest. There is always a risk withadministrative data sources that a beneficiary may be ... data, and enrollment/eli-gibility information from January 1, 2000 forward. A ran-dom 5% sample of Medicare beneficiaries is the standarddata file available to researchers, although the databasecontains...
- 11
- 507
- 0
báo cáo hóa học: " Prevalence of stress, anxiety and depression in with Alzheimer caregivers" ppt
... problems anddepression that has negative repercussions on the family.Table 2: Median values of MMSE, ADL and IADL of patient and caregiver's CBI.Patients CaregiverVariables Median values Variables ... "Dottore Angelico" di Aquino, ItalyEmail: Maria Ferrara* - m.ferrara@unicas.it; Elisa Langiano - langiano@unicas.it; Tommasina Di Brango - tommasina.dibrango@virgiolio.it; Elisabetta De Vito ... implementation of diagnostic and therapeutic procedures related to pharma-cological monitoring protocol "CRONOS "DM20.07.2000".Analysis A database, in Access format, was created and...
- 5
- 398
- 1
Báo cáo hóa học: " Prevalence of and factors influencing posttraumatic stress disorder among mothers of children under five in Kabul, Afghanistan, after decades of armed conflicts" ppt
... participated in the studydesign and conducted a survey, HS took part in data col-lection and data base preparation and KN participated in the study design, data analysis, and editing the manu-script. ... and mental health status of Cam-bodians living in Thailand-Cambodia border camps. JAMA1993, 270:581-586.10. Somasudaram DJ, Sivayokan S: War trauma in a civilian popula-tion. Br J Psychiatry ... determinants of mental well-being. The achieved response rate of 83.7%was attributable to consideration of cultural gender sensi-tivity in Afghanistan and a full communication with theauthorities...
- 5
- 362
- 0
Báo cáo hóa học: " Prevalence of transfusion transmitted virus (TTV) genotypes among HCC patients in Qaluobia governorate" doc
... Gohary A, Hassan A, Nooman Z, Lavanchy D, Mayerat C, el Ayat A, Fawaz N, Gobran F, Ahmed M, Kawano F: High prevalence of hepatitis C virus among urban and rural population group in Egypt. Acta ... 45 s at 60°C, and extension for 45s at 72°C, with the sense primers5'ACAGACAGAGGAGAAGGCAACATG3' (nt 1920–1943,NG059) and anti-sense primer5'CTGGCATTTTACCATTTCCAAAGTT3' ... AccessResearch Prevalence of transfusion transmitted virus (TTV) genotypes among HCC patients in Qaluobia governorateMohamed M Hafez*1, Sabry M Shaarawy1, Amr A Hassan2, Rabab F Salim2, Fatma M Abd...
- 6
- 440
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam