báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt
... 43rd Annual Meet-ing on Association for Computational Linguistics,pages 173–180.Massimiliano Ciaramita and Yasemin Altun. 2006.Broad-coverage sense disambiguation and informa-tion extraction ... 28(3):245–288.Ana-Maria Giuglea and Alessandro Moschitti. 2006.Semantic role labeling via FrameNet, VerbNet and PropBank. In Proceedings of the 21st InternationalConference on Computational Linguistics and ... ascer-tain the contributions of role groups. This datasetconsists of the corpus of FrameNet release 1.3(containing roughly 150,000 annotations), and anadditional full-text annotation dataset....
- 9
- 549
- 0
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx
... Regard-ing the Viterbi alignment in training, the baselineITG constraints yield a similar coverage as the IBMconstraints on the Verbmobil task. On the CanadianHansards task the baseline ITG constraints ... 2002. Discriminative training and maximum entropy models for statistical machinetranslation. In Proc. of the 40th Annual Meeting of the Association for Computational Linguistics (ACL),pages 295–302, ... transduction gram-mars, with application to segmentation, bracketing, and alignment of parallel corpora. In Proc. of the 14thInternational Joint Conf. on Artificial Intelligence (IJ-CAI), pages...
- 8
- 410
- 0
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... that SARSA(λ), Q-Learning, Q(λ) and AC-QV are significantly faster than the restalgorithms. On the other hand, all algorithms except forNAC, IAC and LS-SARSA have the major draw-back of the ... with varying and available action density values. At each run, eachalgorithm was evaluated using the same transitionprobabilities and available actions. To assess how the algorithms respond ... onlinelearning RL algorithms on the dialogue manage-ment problem, in the presence of uncertainty and changes in the environment.Atkeson and Santamaria (1997) evaluate modelbased and model free algorithms...
- 10
- 498
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... the number of epochs, and N is the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these ... first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of these estimators to two additional ... regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model adaptation task. Then we apply the best of these estimators to two additional...
- 8
- 504
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of ... word alignments, and then continuously add new links between backbone and hypothesis if and only if both of the two words of the new link are un-aligned and this link exists in the union of ... Hawaii, US, Oct. F. Huang and K. Papinent. 2007. Hierarchical System Combination for Machine Translation. In Proceed-ings of the 2007 Joint Conference on Empirical Methods in Natural Language...
- 8
- 546
- 1
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... time of the contaminating hydrazone was consistent with the impurity in the l-lactaldehyde preparation being acetone orpropionaldehyde (as shown by comparison with the hydra-zones of acetone and ... hydrazone plus an additionalhydrazone (the contaminant was not present in the unde-rivatized l-lactaldehyde preparation, or the 2,4-dinitro-phenylhydrazine reagent). The mass and retention ... the initiation of the reaction with l-lactaldehyde.Reactions were monitored at 340 nm for the formation of NADH.Western blot analyses of trypanosomatid cellextractsPolyclonal antisera against...
- 11
- 639
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... (Amersham). The intensity of the proteinbands were quantified as absolute integrated optical densityusing labworks imaging and analysis software (UVP,UK). The resulting data were plotted against...
- 16
- 483
- 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt
... translation. In Proceedings of ACL,pages 311–318.Adam Pauls and Dan Klein. 2011. Faster and smallern-gram language models. In Proceedings of the 49thAnnual Meeting of the Association for ComputationalLinguistics: ... ComputationalLinguistics, 37(1):197–230.Ryan McDonald, Koby Crammer, and Fernando Pereira.2005. Online large-margin training of dependencyparsers. In Proceedings of the 43rd Annual Meet-ing of ... et al., 2007).For Chinese-to-English translation, we use the parallel data from NIST Open Machine TranslationEvaluation tasks. The training data contains 353,796sentence pairs, 8.7M Chinese...
- 5
- 410
- 0
Báo cáo sinh học: " A comparative study of some methods for color medical images segmentation" pdf
... uniformity of a region. In contrast, [20,21] use a pairwise region comparison rather than applying a uniformity criterion to each individual region. A number of approaches tosegmentation are based on ... whenpairs of human segmentations of the same image are compared, both the GCE and the LCE are low; conversely, when random pairs of human segmentationsare compared, the resulting GCE and LCE are ... segmentation algorithms. Two of them are well known: the color set back-projection algorithm and the local variation algorithm. The 8 A feature space is the range space of any function of the image,...
- 42
- 349
- 0
Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc
... in the conception and design. CUP was primary responsible in the collection, statistical analysis and interpretation of data and in drafting the manuscript. POH, AD and KSS wereinvolved in the ... the PASS before. The aim of this study was to assess the intrarater and the interrater reliabilityfor the grading of postural balance using a modified ver-sion of the PASS, in patients at a stroke ... In addition, the SwePASS was easy to apply and fast toadminister in clinic.Additional materialAdditional file 1: The Swedish Version of PASS, SwePASS. The manual for using the SwePASS.Acknowledgements...
- 8
- 408
- 0
Từ khóa: a comparative study on generalization of semantic roles in framenetbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM