... and the
rat (distal element) sequence are shown in bold.
MOLECULAR BIOLOGY
INTELLIGENCE UNIT
Tally Naveh-Many
Molecular Biology of the Parathyroid
Molecular Biology
of the Parathyroid
NAVEH-MANY
MBIU
MOLECULAR ... 3'-UTRs (Table 1). In general the difference in size in
Molecular Biology of the Parathyroid
12
the PTH mRNA of the differe...
... β1.
A number of proteinase families are capable of generating the proteolytic fragments of versi‐
can. Matrix metalloproteinase (MMP )-1 , -2 , -3 , -7 , and -9 , ADAMTS-1, -4 , -5 and -9 cleave
versican ... malignan‐
Evolution of the Molecular Biology of Brain Tumors and the Therapeutic Implications10
cies. Elevated versican production occurs in eit...
... transgenic
N. tabacum plants expressing the coding region of the chpA gene of Thermosyne-
chococcus elongatus BP-1 in the cytosol under the control of the CaMV 35S pro-
moter. The transgenic tobacco plants ... for the transgenic plants expressing the Synechococcus fructose-
1, 6-/ sedoheptulose-1,7-bisphosphatase (FBP/SBPase) in order to increase the level
of Ribul...
... meager. In the head-to-tail orientation, the
catalytic site in the N-terminal domain of one subunit and
the substrate recognition site in the C-terminal domain of
the other face each other, thereby ... shape of
the dimeric structure and the key heparin-binding residues
in the N-terminal domain held coordinately by the two
subunits on the top of the hollow (Fig....
... conformation of the Glu-Pro
dipeptide in the hinge region between the last b-strand
and the core of CKS. The crystal structure of the com-
plex of CKS with CDK2 ⁄ cyclin A clearly showed that
only the monomeric, ... revealed the existence of the trans
conformation of the Ser-Pro bond in the peptide sub-
strate. Similarly, the major proline-directed phospha-...
... 5¢-CG
GGATCCCAATCTGTTGCTAA
TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA
AGATCTACCACACCTCCTCATCTCC-3¢) for ampli-
fication of the region from )180 to )36 and (5¢-GA
AGAT
CTAACTAGATTTTACCATTGG-3¢) for amplification
of the region ... particular, calcium-
containing-mineral such as hydroxyapatite [2].
Although the exact m ode of action of MGP at the
molecular level is current...
... from the V
m
⁄ [V
m
⁄ K
m
] ratio [21], then
the specific nucleotide-binding constant (K
d
) was deter-
mined in the absence of 3-phosphoglycerate for each
nucleotide in the wild-type and the double-mutant
enzymes ... affinity.
Hence, the double mutant yielded a very strong non-
additive increment of its catalytic efficiency of 9.2
times for the phosphorylation of the ade...
... that defines the surface of the gap region
[26].
In the interior of the HPV-16 b-barrel, at the inter-
face of each dimer, only one small cavity, present for a
short percentage of the simulation ... S
2
. The order
parameter S
2
[23–25] was calculated from MD simula-
tion for the NH atoms of the E2 chains of both HPV-
16 and BPV-1 (Fig. 4A,B), and in the case o...