Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

... the myristoylation motifs Met-Gly-Xaa-Ala-Ala- Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S). (B, C) Each of the 20 mRNAs corresponding to Myr–AGG1-3X 6A (B) ... Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala- Ala-Ala-Ala (Myr–AGG1-3X6S), with position 3 of each motif separately occupied by e...
Ngày tải lên : 29/03/2014, 21:20
  • 12
  • 473
  • 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

... located at the end of the catalytic domain of rat AChE T or at the beginning of its t peptide, in the )5to6 interval; in these mutants, the original cysteine was either retained or replaced by a ... the presence of dimers, as observed in the case of the other mutants, indicates the formation of an intercatenary disulfide bond. In the hypothesis of a...
Ngày tải lên : 30/03/2014, 13:20
  • 15
  • 333
  • 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... Dissemination, Diversity, and Dynamics of English Borrowings in a German Hip Hop Forum Matt Garley Department of Linguistics University of Illinois 707 S Mathews Avenue Urbana, IL 61801, USA mgarley2@illinois.edu Julia ... token-based precision at recall=95 from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009). Compound-cutting Nominal and adjectival...
Ngày tải lên : 19/02/2014, 19:20
  • 5
  • 537
  • 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

... temperature, are different from a protein that has evolved to be hyperthermostable as a consequence of the adaptation to a factor other than elevated temperature. The availability of an increasing ... the loop are the reason for aggregation at neutral pH. However, the mutation of an additional amino acid in the loop appears to be necessary to further increase prote...
Ngày tải lên : 30/03/2014, 13:20
  • 14
  • 375
  • 0
Tài liệu Báo cáo khoa học: "The Software Architecture for the First Challenge on Generating Instructions in Virtual Environments" docx

Tài liệu Báo cáo khoa học: "The Software Architecture for the First Challenge on Generating Instructions in Virtual Environments" docx

... log of all game events to the Matchmaker, and the client sends the ques- tionnaire results to the Matchmaker; these then are stored in the database for later analysis. All of these components are ... that a generation system generates for them, is recorded in a database. In addition to the questionnaire data, we are thus able to compute a number of objectiv...
Ngày tải lên : 22/02/2014, 02:20
  • 4
  • 359
  • 1
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

... aeruginosa,5¢-AGGCCCGCTTC C GGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢; and A. thermo- aerophilus,5¢-TT GGATCCATGAGAGCCCTAATCACTG GA-3¢ and 5¢-TA GGTACCTTATGCTTGACGGTAACT TTGT-3¢. ... What is more intrigu- ing is that all of the amino acid side chains that have been proposed to function in acid–base catalysis of the 4,6-dehydratase reaction of GMD [27] are...
Ngày tải lên : 16/03/2014, 01:20
  • 15
  • 402
  • 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc

Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc

... C133 (for- ward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢),C176S(forward5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- ... doi:10.1046/j.1432-1033.2003.03519.x GTTTGCCATCTTCG-3¢), C33 (forward 5¢-CTACTT GACTTTCAGTACGTGACC-3¢/reverse 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5...
Ngày tải lên : 17/03/2014, 10:20
  • 8
  • 405
  • 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx

Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx

... type 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ Second ... [22]. Binding of [ 3 H]ouabain as a function of N...
Ngày tải lên : 23/03/2014, 13:20
  • 11
  • 318
  • 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

... constructed according to the following strategy. Two partially complementary oligo- nucleotides 5¢-CGCGGAATTCTTAGTGATGGTGATG GTGATGTGTTGAAGCTTCCTTCAGGG-3¢ and 5¢-CAT CACCATCACCATCACTAAGAATTCCGCGATAGAA GCTTCAACATAAATAGGATACTA-3¢ ... masses higher than that of the remaining dimeric form of the ATP synthase (Fig. 6D). Owing to the destabilization of supramolecular ATP synthase form...
Ngày tải lên : 31/03/2014, 01:20
  • 10
  • 550
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... (2003) Growth signalling pathways in Arabidopsis and the AGC protein kinases. Trends Plant Sci 8, 424–431. 9 Galvan-Ampudia CS & Offringa R (2007) Plant evolu- tion: AGC kinases tell the auxin tale. Trends ... However, the AGC VIII kinases represent a plant- specific sub- family characterized by a conserved DFD amino acid motif in subdomain VII of the catalytic dom...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 700
  • 0

Xem thêm

Từ khóa: