Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... one of these domains and compare their activities and stabilities with those of the intact protein. In this report, the N- and C-domains of SIB1 FKBP22 were overproduced in E. coli and purified in an ... which are spanned by a 40amino acid long a3 helix. The N-domain consists of a1 and a2 helices and an N-terminal region of a3 helix. The C-domain consists of six b-strands (b1–b6), a4 helix, and a ... allows the separation of their N- and C-domains such that the C-domain contains the C-terminal half of the a3 helix [23,24]. In addition, the C-domain of E. coli FkpA shows a high tendency to form inclusion...
- 11
- 332
- 0
Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx
... Surolia N, RamachandraRao SR & Surolia A (2002)Paradigm shifts in malaria parasite biochemistry and anti-malarial chemotherapy. Bioessays 24, 192–196.5 Ramya TNC, Surolia N & Surolia A ... occurrence of a different type (type I) of fatty acid biosyntheticpathway in the human host from that of the malariaparasite, make this pathway an attractive target fordeveloping antimalarial agents ... Separation of apo-ACP and holo-ACP; 12% native PAGEshowing the separation of apo-ACP and holo-ACP by anion exchange chromatography. Lane 1: mixture of apo-ACP and holo-ACP. Lane 2:purified apo-ACP....
- 14
- 419
- 0
Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc
... the rate of productaccumulation (Table 1). These data demonstrate thatChlH enhances both the accumulation and decay of this reaction intermediate, resulting in a reduction in the lag phase of ... show that the magnesiumchelatase H subunit markedly enhances ChlM catalysisby accelerating the formation and breakdown of the catalytic intermediate, providing a kinetic link between the first ... of 50 lmMgD, 1 mm SAM and varying concentrations of ChlH, the porphyrin binding subunit of magnesiumchelatase. MgD was used, instead of MgP, as the con-centration of this water-soluble analogue...
- 8
- 614
- 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx
... surface of the structural unit that contains the catalytic site, ratherthan on an auxiliary domain [9]. These substrate bind-ing sites are located at a certain distance from the active site and ... al. [34]. The protein conce-ntration was calculated based on the values obtained foralanine, threonine, glycine, valine, phenylalanine and aspar-tate. The analysis, starting from protein hydrolysis, ... water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A. niger xylanase mutants to water-unextractable arabinoxylan (C) and oat spelt xylan (D).S. Cuyvers et al. Secondary...
- 14
- 600
- 0
Tài liệu Báo cáo khoa học: "Finding Synonyms Using Automatic Word Alignment and Measures of Distributional Similarity" pdf
... of conveying the same in- formation in different ways are referred to by the term paraphrase and in the case of single wordssharing the same meaning we speak of synonyms.Identification of synonyms ... mul-tilingual setting. In particular, translations of a word into other languages found in parallel cor-pora are seen as the (translational) context of thatword. We assume that words that share ... syntax-based approaches and multilingual alignment-based approaches and compare their performancewhen using the same similarity measures and eval-uation set.2 Related WorkMonolingual syntax-based...
- 8
- 516
- 0
Tài liệu Báo cáo khoa học: Multiple enzymic activities of human milk lactoferrin ppt
... donors (in the parentheses). In all cases, the activity of one subfraction with maximal activity was taken as100% and the activity of other subfractions was calculated as a percentage of that with ... motherscontains subfractions of 150-kDa IgG and 360-kDa sIgAantibodies, which hydrolyze DNA, RNA, and ATP [25,35].After separation of human milk proteins by SDS/PAGE in a gel containing DNA, an in- gel ... only in half of 14 analyzed milk samples. A similarsituation was observed after separation of human milkproteins in a gel containing RNA; again LF was signifi-cantly more active in hydrolysing...
- 9
- 494
- 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... CCTTTGAGCACATTTCGGCAA-3¢P450 aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 2895¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢b-actin 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ 6655¢-3222 AGCCATGCCAAATGTCTCAT-3¢Fig. 1. Dose-related ... AGGTGCTTTGCCAGATATGACT-3¢ 4325¢-802 CTCTTTGATGACAGAAGTGCCT-3¢Syndecan-4 5¢-85 GAGTCGATTCGAGAGACTGA-3¢ 3655¢-450 AAAAATGTTGCTGCCCTG-3¢Glypican-1 5¢-566 GAATGACTCGGAGCGTACACTG-3¢ 4885¢-1054 CCTTTGAGCACATTTCGGCAA-3¢P450 ... estrone and estriol (0.45%). The sensitivity of the assay w as 6 pg pertube. Intra- and interassay coef®cients of variation were lessthan 10%. The analysis o f the radioimmunoassay data wasperformed...
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc
... statements, especially to novices. The ambiguity of natural lang- uage may also interfere with careful thinking about the data stored in the machine. An understanding of onto/into mappings, ... con- trasting natural language and proposed alternatives in paper and pensil studies. Subjects may be asked to write queries to a database of present a sequence of commands using natural language ... helpful in guiding devel- opers of interactive systems and in evaluating the impor- tance of the user's familiarity with: i) the problem domain 2) the data in the computer 3) the available...
- 4
- 363
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... 666 and 670, within one b-strand of domain V, are also important for interdomain interac-tions. The N-terminal part of the strand interacts with the N-terminal part of helix CG in domain G, and ... superimposed on the basis of domains I and II. Looking from the direction of the arrow in (A) and (B), the coordinates of His572 at the tip of domain IV are roughly in one plane, and were manually covered ... Domain V, in helix BVat the interface with domain G. In the ribosome complex, packing against domainIII [22]Mutation to a larger side chain would disrupt the interaction and may in uence the...
- 15
- 474
- 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... forward, CAGGAAGAACCGTTGGAGTT;reverse, TTGCTCTCGTTCCAAAAGGAActb forward, AAGGAAGGCTGGAAAAGAGCreverse, TACAGCTTCACCACCACAGCHmgcs1 forward, TTTGATGCAGGTGTTTGAGGreverse, CCACCTGTAGGTCTGGCASqstm1 ... AGTCCATGAGTTGGCCCATAEgr1 forward, CCTATGAGCACCTGACCACAreverse, AGGCCACTGACTAGGCTGAAEgr1pre-mRNAforward, GAGCAGGTCCAGGAACATTGreverse, GGGATAACTCGTCTCCACCANdrg1 forward, ACCTGCTACAACCCCCTCTTreverse, ... understood in mammals: (a) the target genes and biological processes regulated by amino acid avail-ability, and (b) the signaling pathways that mediate the amino acidresponse. Using large-scale analysis...
- 12
- 560
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam