Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

... Bienkowska-Haba 7216 FEBS Journal 276 (2009) 7206–7216 ª 2009 The Authors Journal compilation ª 2009 FEBS MINIREVIEW Viral entry mechanisms: human papillomavirus and a long journey from extracellular ... the uronic acid and at the 3-O and 6-O position of the amino sugar. The amino group of the glucosamine may be either acetylated or sulfated. The two ma...
Ngày tải lên : 23/03/2014, 04:20
  • 11
  • 511
  • 0
Báo cáo khoa học: Viral entry mechanisms: the increasing diversity of paramyxovirus entry doc

Báo cáo khoa học: Viral entry mechanisms: the increasing diversity of paramyxovirus entry doc

... paramyxovirus family contains established human pathogens such as the measles virus and human respiratory syncytial virus, as well as emerg- ing pathogens including the Hendra and Nipah viruses and the ... peptide into the target membrane and subsequent fusion of the viral and cellular membranes. Attachment proteins and receptors For the majority of paramyxovirus...
Ngày tải lên : 23/03/2014, 04:20
  • 11
  • 244
  • 0
Báo cáo khoa học: Viral entry mechanisms: cellular and viral mediators of herpes simplex virus entry potx

Báo cáo khoa học: Viral entry mechanisms: cellular and viral mediators of herpes simplex virus entry potx

... proteins and receptors, leading to penetration of the viral nucleocapsid and tegument proteins into the cytoplasm. The nucleocapsid is then transported to the nuclear membrane and the viral DNA is ... toward the nuclear membrane for uncoating and the release of viral DNA into the nucleus. Transcription, replication of viral DNA and assembly of progeny ca...
Ngày tải lên : 23/03/2014, 04:20
  • 9
  • 635
  • 0
Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt

Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt

... the Scatchard analysis of the binding data. The calculated constants from these plots (K D1 and K D2 ) are listed in Table 2. Table 2. Affinity and rate constants for ErbB2-ECD ⁄ ligand interactions ... non-linear analysis of the association and dissociation curves using SPR kinetic evaluation soft- ware (package BIAevaluation 3.2, Biacore AB), fitting data to the 1 : 1 Lang...
Ngày tải lên : 23/03/2014, 06:20
  • 13
  • 367
  • 0
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAA TCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTG TCTAAATGCCTTAAGTCCTTGTGTAAGGGACG TATC, ... 5¢-GCGAGG ACCAAGGGGATTCTGGAGCTGAACAAGGTGC AATTGTTGTACGAACAGGTGTGCCAGTCCT...
Ngày tải lên : 30/03/2014, 15:20
  • 13
  • 440
  • 0
Báo cáo khoa học: Unusual stability of human neuroglobin at low pH – molecular mechanisms and biological significance docx

Báo cáo khoa học: Unusual stability of human neuroglobin at low pH – molecular mechanisms and biological significance docx

... Mb and Ngb and the comparison of A B C D Fig. 2. CD characterization of Ngb and Mb at neutral and acidic pH. (A) Far-UV CD spectra of human holoNgb and apoNgb dissolved in 20 m M Tris ⁄ HCl and ... 520–523. 2 Kawada N, Kristensen DB, Asahina K, Nakatani K, Minamiyama Y, Seki S & Yoshizato K (2001) Charac- terization of a stellate cell activation-associated protein (ST...
Ngày tải lên : 07/03/2014, 02:20
  • 13
  • 495
  • 0
Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

... identified. Although calpain 7 contains a C2-like domain, it lacks a penta-EF-hand domain and is classified as an atypical calpain. As one of the significant structural features, mammalian calpain 7 ... (forward, 5¢-TA GGA TCCCCTGGACCCAAGCCAGAAG-3¢; reverse, 5¢-AGA GAATTCTGCCTGGTTTAAGAGACC-3¢; restriction sites underlined) and pCMV3xFLAG–IST1 as a template. The amplified cDNA fragme...
Ngày tải lên : 18/02/2014, 04:20
  • 15
  • 505
  • 0
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

... ADP. On the other hand, the large difference in phosphate donor capacity, only 4% with ADP and no activity with NaPPP and NaPP, indicates that the base part of the phosphate donor must play an ... nucleotides. The results are presented in Table 1 and show that the inorganic polyphosphates are not able to act as phosphate donor. This also shows that phosphate donor capacity...
Ngày tải lên : 18/02/2014, 12:20
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento di Tecnologie ... software (OriginLab Corp., Northampton, MA, USA). Statistical analysis Student’s t-test was applied to the two-sample groups to compare variations in intensity of the control and...
Ngày tải lên : 18/02/2014, 13:20
  • 14
  • 765
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... (1999) Characterisation and mitochondrial localisa- tion of AUH, an AU-specific RNA-binding enoyl-CoA hydratase. Gene 228, 85–91. 17 Nakagawa J & Moroni C (1997) A 20-amino-acid autonomous RNA-binding ... CoA-donor to a CoA-acceptor (Fig. 2). In addition to its natural sub- strate (R)-2-hydroxyglutarate, glutaconate CoA-trans- ferase uses glutaconate, 3-methylglutaconate and ot...
Ngày tải lên : 19/02/2014, 07:20
  • 11
  • 625
  • 0

Xem thêm

Từ khóa: