Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... motif of FhaC. The VRGY
tetrad is highly conserved in the TpsB family and, in FhaC, it is located at
the tip of L6 reaching the periplasm. Replacement by Ala of the invariant
Arg dramatically affects ... against a major con-
formational change of the loop. Structural data are available in the Protein Data Bank under the accession numbers 2QDZ (FhaC
WT
) a...
Báo cáo khoa học: Functional genomics by NMR spectroscopy Phenylacetate catabolism in Escherichia coli docx
... Consequently, the PaaF and PaaH proteins appear to
catalyse reactions in the downstream part of phenylacetate
degradation. In the absence of the PaaF and PaaH proteins,
catabolism of phenylacetate is ... suggests a role for the PaaG and PaaZ
proteins early in the pathway. The other major finding is
that C
6
dicarboxylic acids formed later in the pathway are
deri...
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot
... Schwartzberg
National Human Genome Research Institute, National Institutes of Health, Bethesda, MD, USA
Introduction
Among the key players in intracellular signaling in lym-
phocytes are the Tec family kinases ... cascade of signal-
ing events initiated by the activation of the Src-family
kinase Lck, which phosphorylates immunoreceptor
tyrosine activation motifs on the int...
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... Discussion
Sulfonimides as inhibitors of RNase A
We began by determining the ability of three backbone
analogs of RNA to inhibit catalysis by RNase A.
These analogs have a simple polyanionic backbone
with neither a ... USA
Introduction
Upon catalyzing the cleavage of RNA, RNases operate
at the crossroads of transcription and translation.
Bovine pancreatic RNase A (EC...
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... PCR with GAGCGG
CATATGGA
AATCAAACCGAAGGTTCGCGA and GAGCGG
CATA
TGGAAATCAAACCGAAGGTTCGCGA as the forward
and reverse oligonucleotide primers, respectively. The
primers were designed to introduce ... coordi-
nated by an oxygen donor group derived from the
carboxylate side chain of either a glutamate or an
aspartate. The apparent conflict of this finding with
the absence of a c...
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... staphy-
lococcal adhesins, comprising an N-terminal region that binds fibrinogen
and elastin, and a C-terminal domain that interacts with fibronectin. The
C-terminal domain of fibronectin-binding ... FEBS
Monoclonal antibodies against FnBRs of FnBPB
A panel of mouse mAbs was produced against the
recombinant repetitive region of FnBPB. Analysis of
mAbs binding to the recombina...
Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt
... are
parasitic protozoa belonging to the order Kinetoplast-
ida. They are causative agents of several highly disab-
ling and often fatal diseases, including African sleeping
sickness, Chagas disease ... exhibits another variation in the first steps
of the pathway. C18 FAs are elongated to C20, and
then a D8 desaturase produces the same kind of C20
FAs that will be the substr...
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT
AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG
AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC
TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG
CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT
GACCGCCTCCC-3¢); ... coding
sequence, using primers (5¢-CGTCAAGGAGAAAAAAC
CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC
TGAAGAGGATCTG -3¢) and...
Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx
... isolated
from strains retaining CrtO, this carotene appears to
be in the all-trans form.
A characteristic difference in the carotenoid content
of the PS1-less mutant and the derived strain lacking
echinenone ... Koyama Y, Takii T, Saiki K & Tsukida K (1983) Con-
figuration of the carotenoid in the reaction center of
photosynthetic bacteria. 2. Comparison of the...
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... been
partially induced against the linear isoform of the HNE
peptide. Although the binding pattern may be somewhat
blurred by these antibodies and by the polyclonal nature of
the sera, the importance ... [32].
Evenasmallsidechaininposition388wouldresultinsteric
hindrance with the main-chain nitrogen atom of K389,
damaging the shape of the loop. The above spatial...
Từ khóa:
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật