Báo cáo "On the Oscillation, the Convergence, and the Boundedness of Solutions for a Neutral Difference Equation " pot
Báo cáo " Oscilation and Convergence for a Neutral Difference Equation " pptx
... differentialequations of neutral type, J. Math. Anal. Appl, Vol. 18 (1967).[2] L. H. Huang and J. S. Ju, Asymptotic behavior of solutions for a class of difference equation, J. Math. Anal. Appl., ... oscillations for neutral delay difference equation, J. Math. Anal. Appl. Vol. 166 (1992).[6] B. S. Lalli and B. G. Zhang, Oscillation and comparison theorems for certain neutral delay difference equation, ... 7], the oscillation of solutions of the difference equation (1) was discussed.Motivated by the work above, in this paper, we aim to study the oscillation and convergence of solutions of neutral...
- 11
- 404
- 0
Báo cáo " On some controversially-discussed Raman and IR bands of beryl " pdf
... Colombian and Nigerian samples the Raman shift was around 1068-1070 cm-1 and in samples from Austria, Brazil, China, Madagascar, Russia, South Africa, Zambia, the Raman shift was around 1069-1072 ... Russia (Ural), Madagascar (Mananjary), South Africa (Transvaal), Zambia (Kafubu), Nigeria (Gwantu), China (Malipo) and synthetic ones from Tairus, Biron (hydrothermally-grown), Gilson, Chatham, ... study, the features of both Raman and IR bands (band position and band width) were clearly related to the concentration of Si in the samples. The band width was shown to be broader in the samples...
- 10
- 316
- 0
Báo cáo khoa học: "Combining Orthogonal Monolingual and Multilingual Sources of Evidence for All Words WSD" pot
... orthogonal sources of evidence to create a state -of -the- art system for the task of WSD disam-biguation for AW. Our approach yields an over-all global F measure of 64.58 for the standardSV2AW data ... bank and sawmany beautiful plants there.’ will have the verbs‘walked, saw’, the nouns ‘bank, plants’, the ad-jectives ‘many, beautiful’, and the adverb ‘there’,be disambiguated from a standard ... disambiguation.In the original SALAAM system, the authors au-tomatically translated several balanced corpora inorder to render more variable data for the approachto show it’s impact. The corpora...
- 10
- 443
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... supernatant contained the protein extract. HLA-DR standard, cell lysates and plasma samples were separated using a Mini-PROTEAN® II. The separation gel was a 14% polyacrylamide gel (National Diagnostics, ... sequence. The primers were designed using Primer Select software (DNA Star). Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR ... increased the shedding of HLA-DR from the cell surface and also increased HLA-DR gene transcription may have implications for the therapy of septic patients with GM-CSF as these trials have already...
- 11
- 618
- 0
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx
... information on antibody fragments and nonantibody small scaffold proteins from X-ray and NMR analyses enables the design of and screening for small binding proteins. The preparation of the small ... Fab had high affinity for human VEGF(Kd=60nm). X-ray structural analysis of the complex of another Fab and human death receptor 5confirmed the importance of Tyr residues in the anti-gen–antibody ... are conserved in 200 human A- domains, butother residues are highly variable [56]. By repeatingrandomization of the variable residues, selection of A- domain variants with affinity for a target,...
- 9
- 505
- 0
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt
... CATCGTCATGTTTGAACCRTWF5.1/3¢ GYLNAA a GGCCGCATTGAGATAACCWFZ (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACCRTWF5. 1a/ 3¢ PFIKPR a CCTGGGTTTAATAAATGGActin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGACActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a Primer ... AP-1 factors are involved in cell differenti-ation and survival and are also produced after viraltransformation of cells. The presence of GAAA and AP-1motifs indicates that pleurocidins may ... methodsFish rearing and samplingAll animal procedures were approved by the DalhousieUniversity Committee for Laboratory Animals and the National Research Council, Halifax Local Animal CareCommittee....
- 11
- 415
- 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... interactions via itsside chain, and is in a similar position to Glu132 in A. thaliana PS. Val111 and Gly113, on the other hand,are both affected by both pantoate and ATP. Theseresidues have their ... Srini-vas for help with preparing the clone of nPS, A. Aro-ra, CDRI, Lucknow, for help in collecting the relaxation data, and N. Srinivasan and S. Yamunadevi for their help with modeling and analyzing ... condensation of a molecule of b-alanine with a molecule of pantoate in an ATP-dependent mannerto form pantothenate [1,2]. Pantothenate itself is animportant cofactor that is essential for CoA biosynthe-sis,...
- 16
- 791
- 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... F,W angles far from the allowed Ramachandranregion, are virtually identical to that of FVIIa. Model-ling of Ala372(223) into FVIIa showed that the Cbatom clashed with that of Arg315(170C), and ... procoagulant activity that triggers the clotting cascade [1,2]. Importantly, formation of the binary complex localizes FVIIa to the site of vasculardamage, positions the active site at an appropriatedistance ... with the experimental data, showing reduced enzymaticactivity and S1 pocket maturation but at the same timean unaltered conformational distribution of the N-ter-minal tail and a normal response...
- 11
- 619
- 0
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc
... of cADPRare still a matter of debate. An ADPRC that actsmainly as a cyclizing enzyme has been purified and cloned more than 10 years ago from the ovotestis of Aplysia californica [19,20]. Mammalian ... On the other hand, ectoenzymesproducing cADPR (such as CD38 and CD157) and transport systems for cADPR in the plasma membraneopen the possibility that cADPR acts as a paracrinesignalling molecule ... via a separate cADPR binding protein. In addition to Ca2+release, cADPR also evokes Ca2+entry. The underlying mechanism(s) maycomprise activation of capacitative Ca2+entry and ⁄ or activation...
- 8
- 469
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ