Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt
Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt
... FEBS
MD simulations of the RBP molten globule state E. Paci et al.
Characterization of the molten globule state of
retinol-binding protein using a molecular dynamics
simulation approach
Emanuele Paci
1
, ... unfolded states of human
alpha-lactalbumin by molecular dynamics simulation.
J Mol Biol 306, 329–347.
31 Marchi M & Ballone P (1999) Ad...
Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc
... Foun-
dation. SK was supported by the Maj and Tor Nes-
sling Foundation and PR was an Academy Research
Fellow of the Academy of Finland.
References
1 Baliga BS, Bhatnagar GM & Jagannathan V ... the analysis. The protein content
of the extract was estimated using the Bio-Rad protein
assay, and c-globulin was used as a standard.
Enzyme purification and assays
To pur...
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
... lower
than that of isomaltase, respectively. The K
m
for a- pNPG of
Mun/Bpu was the same a s that of isomaltase, whereas the
K
m
for a- pNPG of M un/Bst was about 50 times l ower than
that of isomaltase. ... Val216 decides the substrate specificity of a- glucosidase
in
Saccharomyces cerevisiae
Keizo Yamamoto
1
, Akifumi Nakayama
2
, Yuka Yamamoto
1,
* and Shiro Tabata...
Báo cáo khoa học: "Completing on the partial basis parses of ill-formed sentences of discourse information" docx
...
what information is available about the AS/400 system.
Candidates AJ N V AJ AJ DET N N
for the POS AV AV
of each word PN PP
Phrases what information is available about the
appears in sentences ... parser, and a
matching pattern with a part of speech rather than
an actual word on one side can be regarded as a
relaxation rule, in the sense that syntactic and se-
manti...
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... (5¢-GCATAGCGATGTGGACGA-3¢) and
QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The
abbreviations ‘Qs’ and ‘Qa’ refer, respectively, to sense and
antisense primers. Accurate amplification of the target
amplicon was checked by obtaining ... sequencing
chemistry.
Real-time quantitative PCR
Quantitative RT-PCR analysis was performed using the
iCycler apparatus (Bio-Rad, Hercules, CA, USA). Total
RN...
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... Kominato Y, Yamamoto F & Takizawa H
(2002) Characterization of the human ABO gene pro-
moter in erythroid cell lineage. Vox Sang 82, 39–46.
34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y &
Kishi ... the
molecular basis for our observations is essential to
evaluate the elevated DNase I activity in the sera of
patients with AMI and to validate the use of serum
DNase...
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization of the interaction between the plasma
membrane H
+
-ATPase of Arabidopsis thaliana and a novel
interactor (PPI1)
Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... plasma membrane
receptor and the activation of the plasma membrane
H
+
-ATPase. IV. Fusicoccin induces the association
between the plasma membrane H
+
-ATPase and the
fusicoccin...
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... 5¢-ATA
CCATGGACAAAACCCACAGTACAATG
P1OH 5¢-
CATATGCACAAAACCCACAGTAC
P2O 5¢-TAT
GGATCCTTAATTAGAAACAAACTGTCTGA
TAAAC
P2OH 5¢-
CTCGAGATTAGAAACAAACTGTCTGATAAACC
P1Z 5¢-ATA
CCATGGCTGGAGAAGACTTTAAGATC
P1ZH ... min, the absorbance of
the supernatant was read at 363 nm. The absorbance of
the reduced form of APAD (APADH) was linear over the
2–100 l
M
range of glutamate with a molar...
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Aiba Y, Nakamura K, Namba T, Hirata
M, Mazda O, Katsura Y & Narumiya S (1993)
Thromboxane A2 receptor is highly expressed in mouse
immature thymocytes and mediates DNA fragmentation
and apoptosis. ... Grazia U, Felli MP, Vacca A, Farina AR, Maroder M,
Cappabianca L, Meco D, Farina M, Screpanti I, Frati L
et al. (1994) Positive and negative regulation of the com-
posite octamer motif...
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... tubingensis (CAA68128.1), Pgx2 Arabi-
dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren-
theses. A question mark indicates ... detail as an extracellular exopec-
tate lyase, releasing unsaturated trigalacturonate as the
major product [20]. We here report on the overproduc-
tion, purification an...
Từ khóa:
- tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf
- lam the nao de tom tat bao cáo khoa hoc
- báo cáo khoa học
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- báo cáo khoa học về cá tra
- báo cáo khoa học nghiên cứu chôm chôm
- trạng thái hiện sinh báo cáo khoa học
- biểu tượng văn học báo cáo khoa học
- tài liệu báo cáo khoa học
- cách trình bày báo cáo khoa học
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)