Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... Pedone et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Functional properties of the protein disulfide oxidoreductase
from the archaeon
Pyrococcus furiosus
A member of a novel protein family related to protein ... about protein disulfide
oxidoreductases in archaea.
A small redox protein w ith a molecular m ass of 12 kDa
was purified from the a...
... 5¢-AAGCT
TCACCATGTACCCTGCCCACATGTACCAAGTG
TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC
ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG
GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or
5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG
TTTACAAGCTG-3¢) ... sets of primers ( 5¢-AAGC
TTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and
5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC
TTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGG
ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and
5¢-TCTAGACTACAGC...
... Increasing amounts
of total cellular DNA were loaded on the gels, as the
hybridization signal in these samples was very low. The
general pattern remained the same: the 19.4-kb band was
weak and a ... intermediate is therefore
crucial for the integrity and maintenance of DNA in all
organisms including mitochondrial DNA (mtDNA).
Mitochondrial DNA amounts to about 15% of t...
... binds
aminoacyl-tRNA (aa-tRNA) and promotes the binding of
the aa-tRNA to the A- site of the mRNA-programmed
ribosome. Upon codon recognition by a cognate ternary
complex (EF-Tu–GTP–aa-tRNA), the ... that the
recombinant proteins have the same number of amino acids
as the native elongation factors.
Activity assays
The concentration of EF-Tu active in binding gua...
... testing in parallel of up to
six different analytes, or up to six different concentrations of
the same analyte, over the target surface.
Concentrations, ranging from 100 to 1000 nm, of each
analyte ... FEBS
Monoclonal antibodies against FnBRs of FnBPB
A panel of mouse mAbs was produced against the
recombinant repetitive region of FnBPB. Analysis of
mAbs binding...
... desaturated by a D4 desaturase to the
same final 22:5 n-6 and 22:6 n-3 PUFAs.
Euglena exhibits another variation in the first steps
of the pathway. C18 FAs are elongated to C20, and
then a D8 desaturase ... cruzi (EAN90580), Euglena gracilis
(AAQ19605), Isochrysis galbana (AAV33631), Pavlova lutheri
(AAQ98793), Thraustochytrium sp. (AAN75710), Thalassiosira pseu-
donana (AAX1450...
... by the mass
increase of 42 mass units. The relative level of acetylation of
a peptide was estimated on the basis of the intensity ratio of
the native and acetylated species. From the data summar-
ized ... of the structural organization of SV-IV
protein. The amino-acid sequence was analyzed using the
BLAST
program to find similar proteins in the ÔnrÕ dat...