Báo cáo khoa học: Production and characterization of a therm

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus Ronnie Machielsen and John van der Oost Laboratory of Microbiology, ... iron- and zinc-containing alcohol dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus. J Bacteriol 181, 1163–1170. 12 Shimizu...

Ngày tải lên : 16/03/2014, 14:20

8
415
0

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The ampliﬁed PCR product was inserted into the ... oxidase, Japanese patent 61115488. 37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent 60062980. 38 Abdel-Raheem A & She...

Ngày tải lên : 19/02/2014, 06:20

14
650
0

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢). These primers contained BstEII and BamHI sites and were used to generate a fragment that was cloned in the same sequencing and ... Aspf1 was generated by RT–PCR ampliﬁcation from a preparation of A. fumigatus mRNA obtained as described [22]. The primers used were: Nt-Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCA...

Ngày tải lên : 16/03/2014, 19:20

9
517
0

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ ... (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse) 75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5...

Ngày tải lên : 19/02/2014, 07:20

19
706
0

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl ... h. The amount of Bip-Pro in the extracellular uptake medium was quantiﬁed according to the laboratory standard HPLC (La-Chrom Ò ; Merck-Hitachi, Darmstadt, Germany) with a diode arr...

Ngày tải lên : 07/03/2014, 05:20

10
490
0

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulﬁde reductase from Pyrococcus horikoshii Implications for the disulﬁde metabolism of anaerobic hyperthermophiles doc

... the enzyme at a disadvantage. Physiological role of CoADR and NAD(P)H in Pyrococcus The maintenance of low intracellular levels of cysteine in organisms has been attributed to the avoidance of the ... form), a signiﬁcant amount of oxidase activity can be observed in the presence of additional substrate-level FAD (Table 2). The k cat app obtained in the presen...

Ngày tải lên : 07/03/2014, 17:20

12
420
0

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... determined according to [56] using BSA as a protein standard. The DNA and amino acid sequence analyses and prediction of the molecular masses were performed with the programs mapdraw and protean in dnastar ... forming the imine linkage with the coenzyme. Enzymes of the b-family catalyse mainly b-replacement or b-elimination reac- tions. The d-alanine aminotransferase...

Ngày tải lên : 16/03/2014, 18:20

14
565
0

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the speciﬁc and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... molecules Fig. 9. The proposed mechanism of catalysis of the b-aryl ether cleavage enzyme. Fig. 8. Mass spectra of guaiacylglycerol and guaiacol, products of the b-aryl ether cleavage reaction. The reaction ... excess of water was added and the resultant precipitate was collected as DHP-GOU. Isolation of the fungi and enzyme Activity of the b-aryl ether cleav...

Ngày tải lên : 17/03/2014, 03:20

10
670
0

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... using an intensifying s creen, at )80 °C. RNA for Northern analyses was isolated as described above and separated in a 1.3% agarose/formaldehyde gel. The RNA was b lotted to a nylon membrane (ZetaProbe, Bio-Rad) ... for details on preparation of the Trx af®nity c olumn). Among the Chlamydomonas proteins that were retained on the column after loading of a protein extract a...

Ngày tải lên : 08/03/2014, 16:20

11
608
0

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially useful in agriculture and medicine because of their antiviral properties ... RIP named pulchellin. It exhibits speciﬁcity for galactose and galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the micro...

Ngày tải lên : 18/02/2014, 16:20

12
763
0