... Bxe _A2 876 (accession number
gi:91782944) was amplified from genomic DNA of B. xenovo-
rans LB400 through a PCR with GAGCGG
CATATGGA
AATCAAACCGAAGGTTCGCGA and GAGCGG
CATA
TGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-
tance in data evaluation. The assistance of T. Pavkov
(Institute of Chemistry, University of Graz) in the
acquisition of CD and DLS dat...
... shallow feature generation meth-
ods could propagate into the model that was
learned from the data. The advantage of this ap-
proach is, however, that training and test data are
homogeneous. A ... .58
Table 1: Classification of it by two annotators in a corpus subset.
4 Automatic Classification
4.1 Training and Test Data Generation
4.1.1 Segmentation
We extracted all instances of...
... Llamazares, M., Garabaya, C., Quesada, V.
& Lopez-Otin, C. (2002) Cloning, expression analysis, and struc-
tural characterization of seven novel human ADAMTSs, a family
of metalloproteinases ... demonstrated that ADAMTS-1 is capable
of generating similar aggrecan fragments to those produced
by ADAMTS-4 and -5 [24]. The finding in a different
laboratory that ADAMTS-1 failed to...
... level.
A grammar element is a grammatical phenomenon
concerned with readability, and its readability level
indicates the familiarity of the grammar element.
In Japanese, grammar elements are classified ... Automatic Detection of Grammar Elements that Decrease Readability
Masatoshi Tsuchiya and Satoshi Sato
Department of Intelligence Science and Technology,
Graduate School of Info...
... object is a database system with a natural
language interface for users. Ideally. the trials are an instrumented
variant of normal uSage. The character of the users, their tasks, the
data, and so ...
general public alike have shown a great intermit in AI, and a
legitimate concern over its social effects- The interest is
especially great in natural language precepting. Howeve...
... ascomycete fungal laccase from
Thielavia arenaria – common structural features of
asco-laccases
Juha P. Kallio
1
, Chiara Gasparetti
2
, Martina Andberg
2
, Harry Boer
2
, Anu Koivula
2
, Kristiina Kruus
2
,
Juha ... observed for MaL, that may determine
the properties of these asco-laccases at high protein concentrations.
Database
Structural data are available in the Protein Data Bank d...
... phytate with pH optima in the
acidic range. They consist of two domains, a large a ⁄ b
domain and a small a domain with the catalytic site at
the interface of the two domains [4,5]. HAPs can initi-
ate ... substrate-free
AppA the C
a
atoms are 2.41 A
˚
apart, whereas for the
substrate-free PhyK and the substrate-loaded AppA
the averaged distance is only 1.87 A
˚
.
Distinct c...
... cerevisiae
strain GIL77
Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAG
GTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCA
AAGGAACTCTTCT-3¢), corresponding to the N- and
C-terminal sequences of b-amyrin synthase from ... derivatives. Bioorg Med Chem Lett
7, 85–88.
51 Banno N, Akihisa T, Tokuda H, Yasukawa K, Higashi-
hara H, Ukiya M, Watanabe K, Kimura Y, Hasegawa
J & Nishino H (2004) Triterpene acids...
... Ohkura, M., Furukawa, K ., F ujimori, H., Kuruma, A. ,
Kawano, S., Hiraoka, M., Kuniyasu, A. , Nakayama, H. &
Ohizumi, Y. (1998) Dual regulation of the skeletal muscle rya-
nodine receptor by ... (Temecula, CA, USA).
Protran nitrocellulose membranes we re from Schleicher
and Schuell (Dasse l, Germany). All other chemicals used
were of analytical grade and purchased from Sigma...