... The Authors Journal compilation ª 2009 FEBS
MINIREVIEW
Apoptosis and autophagy: BIM as a mediator of tumour
cell death in response to oncogene-targeted therapeutics
Annette S. Gillings, Kathryn ... FEBS
providing a rationale for the use of combinations of
MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors.
Indeed, rapamycin, an inhibitor of mammalian...
... Regulation of DNA damage-induced cell death by p53 and HIPK2. Genotoxic stress-induced DNA damage facilitates activation of the
DNA damage-activated protein kinases ATM and ATR. ATR and ATM in turn ... molecular markers
indicative for an active DDR, including site-specifically
Keywords
apoptosis; ataxia-telangiectasia mutated
(ATM); ataxia-telangiectasia mutated
and Rad3-rel...
... this strain
and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine
reports on the chorismate mutase activity ... dehydrogenase protein com-
plexes were replaced by genes encoding monofunctional
versions of the dehydratase and the dehydrogenase. The
growth of this strain on minimal med...
... S, Khachatr-
yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A,
Joachimiak A et al. (2001) Structure of Thermotoga
maritima stationary phase survival protein SurE: a
novel acid phosphatase. Structure ... (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) containing a BamHI site. The gene
was cloned at the NheI...
... the
interface between a solid and a liquid phase, and cal-
culated as the ratio of two rate constants. However,
values of DDG and DDG¢ for mutant Fab fragments,
calculated from values of K
D
and ... which MalE-E3-H6 was
immobilized in the wells of a microtiter plate and the bound
Fab4E11-H6 was revealed with a goat antibody, directed against
mouse Fab and conju...
... Moun-
tains of California. Details of animal holding, feeding and
hibernation were described in [15]. All possible measures
were taken to minimise pain and discomfort during animal
euthanasia in accordance ... phosphofructokinase at 5 °C. Activities are
expressed relative to the PFK activity in the absence of phosphate
at each pH value. PFK activity was measured as descr...
... streptokinase to a fibrin-targeted plasminogen
activator. Proc.NatlAcad.Sci.USA96, 8879–8883.
12. Lin, L.F., Houng, A. & Reed, G.L. (2000) Epsilon amino caproic
acid inhibits streptokinase–plasminogen ... mgÆmL
)1
. Data were recorded using a scan
rate of 50 nmÆmin
)1
and a response time of 1 s. Cuvette
path lengths were 0.1 cm. An average of 10 scans was
obtained. A b...
... C1 and C2 domains appeared to
be joined by a ‘linker’ sequence. Also boxed
are the transmembrane domain and the
serine ⁄ threonine kinase domain.
A. Herpin et al. BMP/activin pathway in Crassostrea ... tract, gills, heart
and labial palp) including female gonads (oocytes),
and from various stages of embryonic and larval devel-
opment (blastula, gastrula, trochophore larvae,...
...
an explanation for the difference between aspectual
information understood as a view on a situation and
temporal features of a situation. The former can be
gained after applying a certain ... the initial and finishing points of a situ-
ation are indicated by I and F respectively. The
duration of the situation can be drawn in two differ-
ent ways: as an unstr...
... immunodiffusion, passive haemaggluti-
nation and inhibition of passive haemagglutination, SDS/
PAGE and immunoblotting using O-antisera against
C. braakii PCM 1531 and PCM 1487.
In double immunodiffusion ... built up of branched trisaccharide
repeating units, in which
D
-ara4dHexisattachedasaside-
chain to a GlcNAc residue in a disaccharide main chain
(structure 2) [6,12...