Báo cáo khoa học: Broad antibiotic resistance profile of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx
Báo cáo khoa học: Broad antibiotic resistance profile of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx
... reverse:
(5¢-GATCTTGCTGCTTACT
GCGGCTCACTACGACC
ATACAGG-3¢)
(5¢-GCACCTGTATGGTCGTAGTGAGC
CGCAGTAAG
CAGC-3¢)
For the Q116N mutant forward and reverse:
(5¢-GATCTTGCTGCTTACT
AACGCTCACTACGACC
ATACAGG-3¢)
(5¢-GCACCTGTATGGTCGTAGTGAGC
GTTAGTAAG
CAGC-3¢)
For ... reverse:
(5¢-GATCTTGCTGCTTACT
AACGCTCACTACGACC
ATACAGG-3¢)
(5¢-GCACCTGTATGGTCGTAGTGAGC
GTTAGTAAG
CAGC-3¢)
For the Q116H mutant forward and...
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
... the program
GNOMOKO
[24]. The
molecular masses were calculated from the ratio of
the forward scattering intensity of the samples and of the
molecular mass standard BSA. The volume fractions of
monomers, ... large amounts of indole-3-acetic acid.
Indolepyruvate decarboxylase, the key enzyme in the
biosynthetic pathway of indole-3-acetic acid, catalyses the
for...
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf
... calculated from the
measured relaxation parameters, that contain contribu-
tions from the overall as well as the local dynamics.
Graphical analysis of the spectral density values pro-
vides a ... the
similar values of the mean and weighed mean s
e
.
Helix II shows the largest variability in local fluctua-
tion frequency, despite the fact that the relative mean
generaliz...
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... for the catalytic modules of other
polymerases [11]. Furthermore, the conservation of
catalytic aspartate residues and their 3D arrangement
suggest that the catalysis mode is probably comparable
with ... domain performs no primase
activity; and (b) after the best possible fit of the Ca
atoms of the catalytic triad, are positional homologs
of the R148 and K300 residues...
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... years as a result of
the expansion of the Aedes aegypti mosquito to dif-
ferent geographic areas, and DHF has spread from
South East Asia to the Western Pacific and the
Americas. A substantial ... epitopes of
the others [63].
The major pharmaceutical companies are currently
developing a treatment against the disease. A tetra-
valent live attenuated vaccine was devel...
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... of the 5¢ exon, and 25 bp
of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC
ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)
contains, in order, a T7 RNA polymerase promoter (nucleo-
tides 1–17), a six-nucleotide ... transcription enhancer, an
EcoRI restriction site, 14 nucleotides of authentic 5¢ exon,
and the first two nucleotides of the Cr.LSU intron. Oligo 158
(26 nucleotides,...
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
... Escherichia
coli. Acta Crystallogr. D 58, 853–855.
12. Yamada, Y., Fujiwara, T., Sato, T., Igarashi, N. & Tanaka, N.
(2002) The 2. 0A
˚
crystal structure of catalase-peroxidase from
Haloarcula marismortui. ... peroxidase
(strain 0157:H7)
Escherichia coli
EuglgraAPX Q8LP26 Ascorbate peroxidase Euglena gracilis
FraganaAPX O48919 Ascorbate peroxidase Fragaria x ananassa
GaldparAPX Q8GT2...
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... matching
with the C-terminal sequence of the coding region: 5¢TTAC
AAGGACAAATTAATTGTGCCAG. For amplification
of the long isoform the same 5¢ primers were used, the 3¢
specific primer was FF3B: 5¢TTACAAGTCTTGCAA
AGGGAAGGAT. ... subtraction
of the spontaneous release of the basophils, the allergen-
induced histamine release was calculated as percent of the
total amount...
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx
... peptides was proposed as the reason of
this apparent increased uptake, as the rate of uptake was
thesameinserum-freemedium[17].Asalreadystated
above, this Tat CPP peptide is able to vectorize various
cargo ... T at peptide uptake i s
under evaluation.
Comparative FACS analysis of the internalization
of the full-length Tat protein construct and the Tat CPP
Differences in the...
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... signal
of the preceding amino acid, correlating the amide HN and
the Ca signals, correlating the amide HN and the Ca signal
of the preceding amino acid, correlating the amide NH with
the Ca and ... of the protein backbone, and for
more than 78% of the side chain atoms.
The main set of backbone u and w dihedral angles was
calculated from the chemical shift val...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro