Báo cáo khoa học: Two conserved domains in regulatory B subu

Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf

... ops alter the binding of the B and C subunits [13]. The B subunits bind to repeats 1±10 of the A subunit, whereas the C s ubunit binds to repeats 11±15. Interactions between the B and C subunits ... loops abrogates the binding of some B subunits but not others [13,28]. The results here de®ne two distinct PP 2A binding domains ...

Ngày tải lên : 08/03/2014, 10:20

7
550
0

Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identiﬁcation of three genotypes that differ in copy number and steroidogenic output pptx

... are two alleles of the same gene (Fig. 3). These data reveal the novel ﬁnding that, in both the South African Angora goat and the Boer goat, CYP17 ACS) and ACS+ are not two alleles of a single CYP17 ... probably originated from two of the subspecies that were used in the breeding of the Boer goat, probably through nonhomologous recom...

Ngày tải lên : 07/03/2014, 06:20

10
548
0

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... catalysis the E376 sidechain swings towards the Ca atom of the substrate, in order to abstract the proton [17]. It seems likely that the ﬁxed charge of the guanidino group of R256 stabilizes the catalytic ... for the inactivity of the R256T mutant protein. Thermostability of the puriﬁed mutant proteins The effect of temperature on MCAD stability wa...

Ngày tải lên : 20/02/2014, 02:21

9
533
0

Báo cáo khoa học: Two overlapping antiparallel genes encoding the iron regulator DmdR1 and the Adm proteins control sidephore and antibiotic biosynthesis in Streptomyces coelicolor A3(2) pdf

... production, i.e. the Adm protein appears to act as a negative regulator of the biosynthesis of undecylprodigiosin. The opposite behaviour of TAadm and TAdmdR1 strains regarding production of antibiotic ... (Roche). Antibodies against Adm, DmdR1 and DmdR2 Antibodies against DmdR1 and DmdR2 were obtained as described previously [15]. Antibodies against a 15 amino acid pept...

Ngày tải lên : 07/03/2014, 02:20

14
435
0

Báo cáo khoa học: Two functionally redundant isoforms of Drosophila melanogaster eukaryotic initiation factor 4B are involved in cap-dependent translation, cell survival, and proliferation doc

... to scan to the initiation codon. eIF4G is a scaffold/adaptor protein which binds to the cap -binding protein e IF4E, as w ell as t o eIF 4A and to further factors such as poly (A) -binding protein (PABP) ... cap-dependent translation as shown in Fig. 4A. Whereas the addition of BSA to the Fig. 3. Dm-eIF 4B- L and Dm-eIF 4B- S are RNA -binding proteins. (...

Ngày tải lên : 07/03/2014, 15:20

14
366
0

Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf

... 5¢-CGAAGTTGGTCGG-3¢ and rpS7-reverse 5¢-GGGAATTCAAAATTAACATCC-3¢; b- actin control speciﬁc primer pairs: b- actin-forward 5¢-TGTTACCAACT GGGACGACA-3¢ and b- actin-reverse 5¢-AAGGAAGGC TGGAAAAGAGC-3¢. Three separate ... FEBS proteins, based on the 3D structure of maize poly- amine oxidase (MPAO), indicated that this region is localized on the tip of the FAD -binding domain, in <...

Ngày tải lên : 07/03/2014, 17:20

8
413
0

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... already available [26]. We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA7 0b (Fig. 1A) . The T-DNA insertion in AtRPA7 0a (atrpa7 0a) was lethal, but the AtRPA7 0b T-DNA ... (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 7 0b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 7 0b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa7 0b. As a control, A. th...

Ngày tải lên : 07/03/2014, 21:20

12
588
0

Báo cáo khoa học: "Multilingual Text Processing in a Two-Byte Code" pdf

... By assigning the same basic code to variations of a single letter (as a, _~, A, A~ , all variants will automatically be alphabetized the ~ame way, which is as it should be. The choice of variant ... European alphabets. They keep a constant f~rm, combining freely with any consonant letter. Alphabets of India and Southeast Asia place vowels above, below, to right o...

Ngày tải lên : 08/03/2014, 18:20

4
322
0

Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot

... HOVY@VAXA.ISI.EDU Abstract As our understanding of natural language generation has increased, a number of tasks have been separated from realization and put together un- der the heading atext planning ... make the hearer feel socially~ subordinate, and yet to be relatively informal These goals play as large a role in generation as the speaker's goal to...

Ngày tải lên : 08/03/2014, 18:20

8
433
0

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... collection of the data in and of itself as the basis for taking relevant action at the farm. They may skip the process of systematic anal- ysis of data and give advice based on their immediate eval- uation ... treat- ment and potential links to data quality. This understanding provides insight into potential errors (bias and random error) related to data based on...

Ngày tải lên : 25/10/2012, 10:45

10
587
0