Báo cáo khoa học: Structural characterization of a novel bra

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The ... heme–GmHO-1 initiates the reaction, as revealed by gradual diminution of the Soret band. After several minutes, a broad band appears at around 660–675 nm; this increases in inte...

Ngày tải lên : 19/02/2014, 05:20

16
617
0

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... and complementary mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and...

Ngày tải lên : 18/02/2014, 11:20

15
635
0

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... sites. In the case of the titin and twitchin kinases, the autoinhibitory sequence acts as a pseudo- substrate, occluding ATP binding and preventing protein substrates from binding (reviewed in [9]). PhK ... An intrinsic calmodulin (CaM, the d subunit) binds directly to the c protein kinase chain. The interaction site of CaM on c has been localized to a C-terminal ext...

Ngày tải lên : 19/02/2014, 17:20

12
590
0

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... thioester acyl–enzyme intermediate. Biochemistry 49, 341–346. 3 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for ... than that from RN4220, MW2 or MSSA476 strain, indicating that shorter fatty acids were mainly attached to the tria- cylated lipopeptides of SitC of the SA113 strain (Figs 1A an...

Ngày tải lên : 06/03/2014, 01:20

13
407
0

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... macromolecule-64 (OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains the inner ear-speciﬁc collagen otolin-1 [9]. Results Cloning ... However, the structural and biochemical bases of the biomineralization framework and mineral- associated protein have not been elucid...

Ngày tải lên : 18/02/2014, 17:20

12
568
0

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... staphy- lococcal adhesins, comprising an N-terminal region that binds fibrinogen and elastin, and a C-terminal domain that interacts with fibronectin. The C-terminal domain of fibronectin-binding ... FEBS Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the recombina...

Ngày tải lên : 06/03/2014, 22:21

16
560
0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed to introduce ... coordi- nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or an aspartate. The apparent conﬂict of this ﬁnding with the absence of a...

Ngày tải lên : 18/02/2014, 06:20

15
624
0

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... [46]. Other sta- tistical approaches analysing structural parameters in large samples of dissimilar proteins regarding the origin and temperature range, do not show signiﬁcant trends regarding the ... adequate to maintain their active conformation. In order to improve the understanding of the structural principles of temperature adaptation we studied a subtilisin-like...

Ngày tải lên : 19/02/2014, 16:20

14
597
0

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... resultant binding and selective alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating ... supercoiled, linear and relaxed-circular plasmid DNA, in order of increasing apparent molecular weight (Fig. 3A) . Comparison of the ethidium ﬂuorescence (Fig. 3A) and t...

Ngày tải lên : 20/02/2014, 11:20

10
638
0

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modiﬁcation sites and structural requirements for substrate processing and subcellular localization pptx

... protease core) had a C-terminal hexahistidine tag. The catalytic domain was expressed as a GST-6XHis N-terminal fusion protein. Variants designed for expression in mammalian cells had an N-terminal ... require the interaction with a rapidly titrated endogenous factor, rather than a NLS [46]. Remarkably, the TRAF domain of USP7 also interacts with several nuclear proteins suc...

Ngày tải lên : 07/03/2014, 05:20

15
592
0

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus inﬂuenzae pot