Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... 2455
The effect of replacing the axial methionine ligand with
a lysine residue in cytochrome c-550 from Paracoccus
versutus assessed by X-ray crystallography and unfolding
Jonathan A. R. Worrall, ... form, albeit
with the axial ligand still intact, with the main- and
side-chain atoms of K99 flipped up and away from the
heme...
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA
CAUUAAAG-3¢, antisense, 3¢-UAUCCUGAAGAACUU
UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense,
5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢,anti-
sense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢.
Another ... Takahashi K, Takeda K,
Furuyama K, Kaneko K, Takahashi S, Tamai M &
Shibahara S (2004) Expression of heme oxygenase-1 is
repressed by interferon-gamma and induced b...
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... purification ensured that the
recombinant proteins have the same number of amino acids
as the native elongation factors.
Activity assays
The concentration of EF-Tu active in binding guanine
nucleotides, ... density is caused by the binding of a
deacylated tRNA to the ribosome rather than by a
change in the synthesis of (p)ppGpp. Deacylated tRNA
has a high co...
Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt
... of plasma alanine
aminotransferase (AlAT), aspartate aminotransferase
(AsAT) and LDH was assessed. The present study also
investigates the anti -in ammatory property of curcu-
min and capsaicin ... curcumin, capsaicin
and their combination on carrageenan induced
in ammation
To examine the postlocal anti -in ammatory potential of
the combination of spice principles curc...
Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"
... comparison of the indi-
vidually observed and predicted time values and for
comparison of within-group changes a repeated
measures analysis
of variance was used. If analysis of
variance showed an ...
patients had a normal left ventricular cavity size and
baseline ejection fraction as evaluated by radionuclide
angiography. Coronary artery disease was excluded
by...
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAGACTAGTGGTTAGAGGAGA
GGAATGATGCTGTAGAGACA
DENV-1 92.1 ± 0.57 73.6 ± 2.31
1G4P217 ATATGCTGAAACGCGTGAG
CATCATGAGACAGAGCGAT
DENV-3 90.3 ± 1.09 83.9 ± 5.16
1G5P30 TTCCAACAAGCAGAACAACAT
GCTACAGGCAGCACGGTTT
DENV-4 ... Group 4 ATATGCTGAAACGCGTGAG
CATCATGAGACAGAGCGAT
DENV-3 104
382
279
1G5P30 Group 5 TTCCAACAAGCAGAACAACAT
GCTACAGGCAGCACGGTTT
DENV-4 9903
10318
415
C. Gijavanekar et al. PCR detection...
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf
... cellular retinaldehyde-binding protein. After 2 h of incuba-
tion at 37 °C in the dark, the generated retinoids were
extracted with 300 lL of methanol and 300 lL of hexane
and analyzed by normal-phase ... (A)
The lipid amount in each flotation fraction
was quantified by scintillation counting of
[
14
C]PC and expressed as a percentage of
the total amount of...
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
... communicated by the switchboard operators
through the hospital loudspeakers and paging system, and a
detailed log of all calls is maintained.
Criteria for medical emergency team activation
Calling ... this to aspects of nursing and medical
daily routine.
Materials and methods
The hospital
Austin Health is a university-affiliated teaching hospital with
three hospital...
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt
... interactions of tau and Fyn may play
an important role in regulating the cellular localization
of Fyn and tau.
Results
Tau interacts with Fyn-SH2
Because tau contains tyrosines that could be targeted
by ... also an increase in the amount of
DRM-associated tau isolated from wild-type neurons
(Fig. 5A) . In contrast, pervanadate did not appear to
induce any change in...
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... sites are
located in the concave face of the protein near regions
of invariant Trp and Asn arrays. The major binding
site spans ARM repeats 2, 3 and 4 (Fig. 1A) . In the
major binding site, the ... NLS in an extended conformation.
Database
Structural data are available in the protein Data Bank under the accession number
3OQS.
Structured digital abstract
l
CLIC4...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật