Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... FEBS 2003 Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase Bjørnar Synstad 1 , Sigrid Ga ˚ seidnes 1 , Daan M. F. van Aalten 2 , ... the glutamate that acts as the catalytic acid. The active site grooves of these chitinases are lined with aromatic amino acids that contribute to...
Ngày tải lên : 07/03/2014, 14:20
  • 10
  • 651
  • 0
Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

... con- taining 20% (v/v) glycerol. Data were collected using a CCD camera at the BL 6A station of the Photon Factory (Tsukuba, Japan) and the BL38B2 and BL40B2 stations of SPring-8 (Harima, Japan), at ... the Cc2atomofaThr109 and the Cc1atomofaVal136 is 3.7 A ˚ . On the other hand, in Fe-type NHase, the side-chain of the corresponding serine residue does not i...
Ngày tải lên : 16/03/2014, 16:20
  • 10
  • 510
  • 0
Tài liệu Báo cáo khoa học: "Subjectivity and Sentiment Analysis of Modern Standard Arabic" doc

Tài liệu Báo cáo khoa học: "Subjectivity and Sentiment Analysis of Modern Standard Arabic" doc

... Linguistics Subjectivity and Sentiment Analysis of Modern Standard Arabic Muhammad Abdul-Mageed Department of Linguistics & School of Library & Info. Science, Indiana University, Bloomington, USA, mabdulma@indiana.edu Mona ... subjectiv- ity in these sentences. They use POS features, lex- ical features, and a paragraph feature and obtain an average accuracy on subjec...
Ngày tải lên : 20/02/2014, 05:20
  • 5
  • 581
  • 0
Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot

Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot

... cytoplasmic 1 c-Actin Actin, cytoplasmic 1 Tubulin b Tubulin a Ankyrin repeat domain-containing protein 1 8A Ankyrin repeat domain-containing protein 1 8A Heat-shock protein b1 a- Actin-2 Unclassified Keratin, ... 3551–3567. 88 Wakeyama H, Akiyama T, Takahashi K, Amano H, Kadono Y, Nakamura M, Oshima Y, Itabe H, Nakayama KI, Nakayama K et al. (2007) Negative feedback loop in the Bim-c...
Ngày tải lên : 06/03/2014, 22:21
  • 22
  • 424
  • 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... structure of the proteins. We assigned the binding sites of these two AAA-proteins to their different protein regions and elucidated the importance of ATP-binding to the two AAA-cassettes of Pex1p and ... both AAA-peroxins AB DC EF Fig. 4. Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex1p on the morphological appearance of...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 584
  • 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... contained IAEDANS or IANBD bands, indicative of covalent binding of the dyes [19]. Binding activities of Ag-NPA-1 Binding of fatty acids, retinol and DAUDA were studied by changes in the intrinsic ... [30]). A value of 1.36 was taken for the refractive index n [31]. MALDI-TOF analysis MALDI-TOF analysis of the peptides obtained after tryptic digestion of the...
Ngày tải lên : 16/03/2014, 18:20
  • 10
  • 501
  • 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx

Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx

... 5¢-CTTGCAGTGAGCTGAGATCATAA CAAT GACTCCAGCCTGGGCAACAGAG-3¢; M-D sense primer, 5¢-TGGGAATGTGAGGCTGGGGG TCTTCTTT CGGAACGCTGCTTCTCAAGGG-3¢; and M-D antisense primer, 5¢-CCCTTGAGAAGCAGCGTTCC GAAAGA AGACCCCCAGCCTCACATTCCCA-3¢. ... cis-elements in the TRANSFAC 7.0 database (http://www.generegulation. com/pub/databases.html) [28]. After scanning the TRANSFAC 7.0 database, we found that the...
Ngày tải lên : 30/03/2014, 04:20
  • 14
  • 340
  • 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... 764pA::GUS ) 234AF AAAAAGCAGGCTGAGAAATCTATGGAATAAATAAAAATTAGGG b ) 234pA::GUS PromAR AGAAAGCTGGGTCGATGTTTCACTGAAACATTAATAGATATTC b,c All chimeric cardosin A constructs except pADi::GUS PromARDi AGAAAGCTGGGTCGATGTTTCATCACGTGTTATTTGATGGAAGCAATG b,c,d pADi::GUS ) ... 2912pA::GUS and pADi::GUS ) 1792AF AAAAAGCAGGCTTGCTGTTCTAAGTGTACTAGCTGGA b ) 1792pA::GUS ) 1263AF AAAAAGCAGGCTCAAATTAAATCGACGG...
Ngày tải lên : 30/03/2014, 09:20
  • 17
  • 359
  • 0
Báo cáo khoa học: Thermodynamic and kinetic analysis of the isolated FAD domain of rat neuronal nitric oxide synthase altered in the region of the FAD shielding residue Phe1395 docx

Báo cáo khoa học: Thermodynamic and kinetic analysis of the isolated FAD domain of rat neuronal nitric oxide synthase altered in the region of the FAD shielding residue Phe1395 docx

... (Stratagene) and the forward primer 5¢-GCAATCATATGAGCTGGAAGAGGAACAAGTT CCG-3¢ and the reverse primer 5¢-GGATCCTTAGGA GCTGAAAACCTCATCTGCG-3¢, containing NdeIand BamHI restriction sites, respectively. The ... reduction potentials of flavin cofactors, and also of the haems in the case of NOS and P450 BM3. In spectroelectrochemical titrations of the isolated domains...
Ngày tải lên : 30/03/2014, 14:20
  • 13
  • 364
  • 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... domain of a taxin-2 and the deubiquitinating Josephin domain o f ataxin-3. We also speculate about dis- tant evolutionary relationships of ubiquitin-binding UIM, GAT, UBA and CUE domains and helical ... amino acid 254–345) [37] and LsmAD (Lsm- associated doma in, amino acid 353–475). The LsmAD domain of ataxin-2 contains both a clathrin-mediated trans-Golgi signal (YDS,...
Ngày tải lên : 30/03/2014, 15:20
  • 16
  • 526
  • 0

Xem thêm

Từ khóa: