Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... with
oligonucleotides 5¢-CCCCATATGATGAGGACAGATT
CATCAAAAATG-3¢ and 5¢-CATGGATCCTCATTTT
TCTTCATTTTGAGGC-3¢. The amplified PCR fragment
was inserted into plasmid vector pET between the endo-
nuclease sites NdeIandHindIII. ... signal ATTAAA (1018–
1023) and poly (A) tail (Fig. 1). The human PKIb protein
predicted by the open reading frame is 78 amino acids in
length with a calcula...
... of the two
A. thaliana arogenate dehydrogenases TyrAAT1 and TyrAAT2 deduced
from their respective coding sequences (A) and alignment of amino acid
sequence of the two protein domains of TyrAAT1 ... synthase and shiki-
mate kinase, and not less than six for arogenate
dehydratase. Analysis of the patterns of expression of
the two A. thaliana arogenate dehyd...
... two additional residues, Leu
and Val, at the C-terminus, which are cleaved during
maturation.
Fig. 2. cDNA and the deduced precursor
sequence of conomarphin. The signal pep-
tide is shadowed and ... shadowed and the mature peptide is
underlined. The polyA signal AATAAA in the
3¢-UTR is also underlined. The cDNA of con-
omarphin has been deposited in the Gen-
bank d...
... nucleotide and amino acid are indicated in the
right of each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A
putative signal ... Relative positions of
Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and
HdFull-DNA are indicated as solid lines. Bold lines in both sides of the
cDNAsindicateprimersusedfort...
... residue are indicated. (B) The assignments of the
1
H-resonances of the GlcNAc and Gal II residues are indicated.
The spectrum was recorded in D
2
O at pH 7.0 and 295 K.
4016 A. D. Cox et al. ... acceptor the
sialylated tetrasaccharide unit cannot be attached. In strain
RM118, and the RM118 lgtC mutant strain, we have now
identified two different sialylated species, n...
... PCR
using the 5¢-primer (CGCCATATGGCTACTAAAGCTG
CTCGTGTTCCACGTACAGTGCTGCCA) and 3¢-primer
(GCGAAGCTTAATGATGATGATGATGATGGTTGAT
GGCTCTGAAGGTGAGGAG) and inserted into the
NdeI ⁄ HindIII-digested pET17b ... expression of AdR and
Adx. The plasmid containing the coding sequence for AdR
was kindly provided by Y. Sagara [32]. Recombinant Adx
and AdR were purified as described previou...
... addition, the
N-terminal and internal amino-acid sequences deduced
from the cloned gene were the same as those determined
by Edman degradation.
The recombinant protein expressed by E. coli was
purified ... degra-
dation (data not shown). Another insecticidal protein was
also purified from fraction ii. This protein migrated as a
single band at a molecular mass of 34 kDa...
... collected from the lagoon of Thau (N.W.
Mediterranean sea) and placed on ice for transport to the
laboratory. They were then transferred to a 200-L aquarium
filled with natural aerated sea water, in a ... cross-reacted with antisera
to pi and alpha classes and the isoform 5-5 cross-reacted with
the antisera to mu and pi classes. Subunit 4 was recognized
by the three a...
... partial deletion
of exon 2. However, this deletion did not disrupt protein
translation and thus the alternative spliced mRNA
remained in-frame and potentially translated into a 182
amino acid ... cytokine.
Materials and methods
Cloning and sequencing of genomic DNA and cDNA
All products amplified by PCR were ligated into the
pGEM-Teasy vector (Promega) and transformed i...