... the
excess heat capacity vs. temperature thermogram of the
sample. The baselines before and after transition were selec-
ted for the thermogram with the origin 7.0 program, and
the transition enthalpy, ... confers thermodynamic and
biochemical stability
Akshaya K. Meher
1
, Naresh Chandra Bal
1
, Kandala V. R. Chary
2
and Ashish Arora
1
1 Molecular and Structural Biology, Cent...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
... translocation and transcriptional activation
of MRTFs, and Rho activity is crucial for actin
dynamics. Kuwahara et al. [54] showed that the
dominant-negative RhoA mutant inhibits the nuclear
accumulation ... MRTFs and SRF activity. Taken together,
the small GTPase acts downstream of STARS, and it
seems possible that ABLIM integrates signals from the
small GTPases, Rac and RhoA (...
... is
that typical of a flavoprotein with bands centered at 381 and
452 nm and shoulders at 422 and 473 nm. Maximal
absorbance in the ultraviolet region was at 272 nm. A value
of 7.0 for the A
272
/A
452
ratio ... the fractional absorbance change at 452 nm
as a function of dithionite/FAD molar ratio. A
i
and A
f
are the initial
and final values of absorbance at 452...
... protein folding and degradation. Proc
Natl Acad Sci USA 96, 11033–11040.
16 Weibezahn J, Schlieker C, Bukau B & Mogk A (2003)
Characterization of a trap mutant of the AAA+ chap-
erone ClpB. ... Journal compilation ª 2008 FEBS
Mycobacterium tuberculosis ClpC1
Characterization and role of the N-terminal domain in its function
Narayani P. Kar, Deepa Sikriwal*, Parthasarat...
... covalent modifications of the enzyme, the
effect of the inhibitor on the molecular mass value of
HAD was measured; instead of an adduct increase, or
no change, the value had unexpectedly decreased from
22 ... 4 Da, the
decrease of the molecular mass value. The most proba-
ble reason for a 2 Da decrease is the formation of an
S–S bond; although this was tota...
... immature
enzyme forms and black arrows the mature forms. (B) Quantitative
analysis of mature TACE degradation by Western blot. The ratio of
mature TACE to immature TACE was determined in the absence ... involved in a mechanism which decreases
the amount of mature TACE (Fig. 5).
Discussion
The prodomain of the catalytically active members of the
ADAM family is thoug...
... in analysis
and synthesis. It also explains the gap in
semantics and logical meaning, and gives a clear
computaional image of what we call conceptual
analysis.
This grammar is used for analysis ... FTABLE and THESAURUS
Knowledge Base consists of LEXICON,
THESAURUS and FTABLE.
The case grammar, as a basis of internal
representation, which is constructed with the
com...
... necessary to raise the
redox potential to a value that facilitates proper cataly-
sis. On the other hand, there are also examples of
proteins that normally do not contain a covalent
flavin, but have ... activity was
measurable, it was clear that the microenvironment
around the isoalloxazine moiety of the FAD analog
cofactor was dramatically affected [89]. This shows
that even...