Báo cáo khoa học: A novel mechanism of V-type zinc inhibitio

Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efﬁcient catalysis doc

... Authors Journal compilation ª 2011 FEBS 3151 A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efﬁcient catalysis Jaclyn ... that the V-type inhibition produced with glutamate as the substrate results from disruption of subunit interactions necessary...

Ngày tải lên : 05/03/2014, 23:20

12
544
0

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sense CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ... 3T3 ﬁbroblasts. These data reveal a novel mechanism of cross-talk between the classical TGFb ⁄ Smad pathway and Rho GTPases, regulating the rapid and the l...

Ngày tải lên : 16/03/2014, 06:20

14
420
0

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ (antisense). Caspase 3 activity Cells ... intensity was determined using imagemaster 2d elite software 4.01 (Amersham Bioscience, Uppsala, Sweden). Statistical analysis Data in bar graphs are expressed as the mean and standard deviation...

Ngày tải lên : 18/02/2014, 18:20

12
613
0

Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt

... tachykinins: a review. Zool Sci 5, 533–549. 7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy- ama M, Minakata H, Chiba T, Metoki H, Satou Y & Satoh N (2004) Tachykinin and tachykinin receptor of an ascidian, ... vulgaris). Biochem J 387, 85–91. 25 Kanda A, Takahashi T, Satake H & Minakata H (2006) Molecular and functional characterization of a novel gonadotropin-releasing-h...

Ngày tải lên : 19/02/2014, 00:20

11
595
0

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

... the data above allowed the identiﬁcation of the carbohydrate backbone from alkaline degradation of the rough form LPS from P. stutzeri OX1. Isolation, NMR and MS analyses of oligosaccharide 2 from ... Gram-negative bacteria, and their adaptability to many different pollutants [1]. Pseudomonas stutzeri OX1 is a Gram-negative bacterium isolated from the activated sludge of a...

Ngày tải lên : 19/02/2014, 13:20

14
715
0

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentaﬂuorophenylhydrazine was ... only as a carbon source, but also as a nitrogen source for g rowth of the assimilating bacteria. Deaminases, which catalyze the release of ammonia, are a key enzyme in the metab...

Ngày tải lên : 19/02/2014, 16:20

7
613
1

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatest detail is the pathway of nicotine ... pair 5¢-GAC CTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear- ing the restriction e nzyme recognition sites Bam HI and XhoI, respectively. pAO1 DNA, isola...

Ngày tải lên : 19/02/2014, 16:20

8
647
0

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magniﬁca – a step into the invertebrate world of proteases pdf

... gamus, Molgula occidentalis and Pyura vittata); 11 species of Cnidaria (Bartholo- mea annulata, Budonosoma granulifera, Cassiopea xamachana, Condylactys gigantea, Gorgonia ventalina, Lebrunia ... screened for CPA activity using AAFP as a substrate: four species of Mollusca (Aplysia dactylomela, Aplysia juliana, Isognomun radia- tus and Lima scabra); four species of Chordata (Pallu-...

Ngày tải lên : 07/03/2014, 02:20

16
628
0

Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

... against a shifting target: a structural basis for resistance to inhibitors in a variant of inﬂuenza virus neuraminidase. Structure 6, 735–746. 13 Ely B & Pittard J (1979) Aromatic amino acid biosynthesis: ... inhibitory concentration was about 0.41 lm. The results indicate that binding of ATB107 reduces the catalytic activity of mIGPS, and that ATB107 is a high-afﬁnity i...

Ngày tải lên : 07/03/2014, 03:20

11
440
0

Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s ﬂuorescent probe for the determination of glutathione doc

... processes such as transport, protein synthesis, catabolism and metabolism [1]. It can also protect cells against reactive oxygen species and help them maintain an adequate intracellular redox status [2]. ... centri- fuged at 1000 g for 1 min at room temperature to remove cells and platelets [10]. Afterwards, 0.50 mL of absolute alcohol was added to the plasma with shaking. Plasma proteins...

Ngày tải lên : 07/03/2014, 05:20

8
429
0