Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig. 1C). ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAAT...
Ngày tải lên : 21/02/2014, 03:20
  • 11
  • 506
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... filter paper assay and tritium-labeled substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k cat was calculated using M w (HPRT) = 27132...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMP kinases from gram-negative and gram-positive bacteria. J Biol Chem 282, 7242–7253. 18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin A& amp;Baˆ rzu O (1998) Mutational analysis of UMP kinase ... Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 Department of Anatomy, Phys...
Ngày tải lên : 18/02/2014, 16:20
  • 12
  • 656
  • 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... members of family 28 of the glycoside hydrolases, including the endopolygalacturonases, exo- polygalacturonases and rhamnogalacturonases [3,4]. Although a handful of endopolygalacturonases, gener- ally ... tubingensis (CAA68128.1), Pgx2 Arabi- dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in pare...
Ngày tải lên : 20/02/2014, 03:20
  • 10
  • 592
  • 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani He ´ ctor Villa 1 , Yolanda Pe ´ rez-Pertejo 1 , Carlos Garcı ´ a- Estrada 1 , Rosa M. Reguera 1 , ... donovani as well as its expression and molecular characterization. Materials and methods Materials Plasmids pGEM-3Zf(+) and pQE30 were from Promega and QIAGEN, respectively....
Ngày tải lên : 21/02/2014, 00:20
  • 9
  • 487
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...
Ngày tải lên : 15/02/2014, 01:20
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... an unusual feature shared by only a handful of prokary- otic CYP proteins [4,8,25]. In comparison, the NOS flavoprotein domain is related to a family of dual-flavin enzymes that contain FAD and FMN, and ... prevented an accurate measure of the k off parameter in CaM-bound eNOS and nNOS [58], and thus prevented assessment of the relative importance of conformational change...
Ngày tải lên : 18/02/2014, 11:20
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... cur- rently available, it appears that it is appropriate to describe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reorganization energy. The ... 2009) doi:10.1111/j.1742-4658.2009.07121.x At least half of all enzyme-catalysed reactions are thought to involve a hydrogen transfer. In the last 10 years, it has become apparen...
Ngày tải lên : 18/02/2014, 11:20
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... cysteines located in both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the cytosolic site (Fig. 1A) [2,7,13–16]. ... G, Kusunoki M, Aoki S, Sato D, Kobayashi T, Kita K, Horii T & Hase T (2007) Cloning and characterization of ferredoxin and ferredoxin–NADP + reductase from...
Ngày tải lên : 18/02/2014, 11:20
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... The core of the pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium Su...
Ngày tải lên : 18/02/2014, 14:20
  • 10
  • 553
  • 0

Xem thêm

Từ khóa: