Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... Canyuk B, Focia PJ & Eakin AE (2001) The role for
an invariant aspartic acid in hypoxanthine phospho-
ribosyltransferases is examined using saturation muta-
genesis, functional analysis, and ... filter paper assay and tritium-labeled
substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k
cat
was calculated using
M
w
(HPRT) = 27132...
... UMP
kinases from gram-negative and gram-positive bacteria.
J Biol Chem 282, 7242–7253.
18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin
A& amp;Baˆ rzu O (1998) Mutational analysis of UMP
kinase ... Ureaplasma
parvum UMP kinase – a potential antibacterial drug target
Louise Egeblad-Welin
1
, Martin Welin
2,
*, Liya Wang
1
and Staffan Eriksson
1
1 Department of Anatomy, Phys...
... members of family 28 of the glycoside
hydrolases, including the endopolygalacturonases, exo-
polygalacturonases and rhamnogalacturonases [3,4].
Although a handful of endopolygalacturonases, gener-
ally ... tubingensis (CAA68128.1), Pgx2 Arabi-
dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in pare...
... Molecular and functional characterization of adenylate kinase 2
gene from
Leishmania donovani
He
´
ctor Villa
1
, Yolanda Pe
´
rez-Pertejo
1
, Carlos Garcı
´
a- Estrada
1
, Rosa M. Reguera
1
, ... donovani as well as its expression
and molecular characterization.
Materials and methods
Materials
Plasmids pGEM-3Zf(+) and pQE30 were from Promega
and QIAGEN, respectively....
... an
unusual feature shared by only a handful of prokary-
otic CYP proteins [4,8,25].
In comparison, the NOS flavoprotein domain is
related to a family of dual-flavin enzymes that contain
FAD and FMN, and ... prevented an
accurate measure of the k
off
parameter in CaM-bound
eNOS and nNOS [58], and thus prevented assessment
of the relative importance of conformational change...
... cur-
rently available, it appears that it is appropriate to
describe H-tunnelling reactions using Marcus theory,
and that a general feature of these reactions may be a
large reorganization energy.
The ... 2009)
doi:10.1111/j.1742-4658.2009.07121.x
At least half of all enzyme-catalysed reactions are thought to involve a
hydrogen transfer. In the last 10 years, it has become apparen...
... cysteines located in both of the large PSI subunits,
PsaA and PsaB, via a loop that also plays a role in the
attachment of PsaC [12]. PsaC, PsaD and PsaE are
located at the cytosolic site (Fig. 1A) [2,7,13–16]. ... G, Kusunoki M, Aoki S,
Sato D, Kobayashi T, Kita K, Horii T & Hase T
(2007) Cloning and characterization of ferredoxin and
ferredoxin–NADP
+
reductase from...
... (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) containing a BamHI site. The gene
was cloned at the NheI and BamHI sites of ... The core of the pro-
tein is made up of a nine-stranded b-sheet flanked by
a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1
Structure of Salmonella typhimurium Su...