Tài liệu Báo cáo khoa học: Adaptive changes in the expressio

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia C. Vijayasarathy 1, * ,† , ... though the catalytic eﬃciency of the enzyme (TN for cytochrome c oxidase) remained nearly the same. Increased glycolytic ﬂux and alterations in the kinet...

Ngày tải lên : 20/02/2014, 23:20

9
554
0

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... toxin is cleaved by furin into two fragments: the A chain corresponding to the catalytic domain (C domain); and the B chain corresponding to the translocation domain (T domain) and the receptor-binding ... The acidic pH in the endo- some triggers a conformational change, leading to insertion of the toxin in the membrane. The C domain is then translocated acr...

Ngày tải lên : 16/02/2014, 09:20

10
530
0

Tài liệu Báo cáo khoa học: "Adaptive String Distance Measures for Bilingual Dialect Lexicon Induction" pdf

... a training lexicon consisting of correct word pairs. The initial transducer contains uniform probabilities. It is used to transduce the word pairs of the training lexicon, thereby counting all ... that these two tech- niques can be combined efﬁciently. They use Rapp’s co-occurrence vectors in combination with Mann and Yarowsky’s EM-trained transducer. 3 Two-Stage Models of L...

Ngày tải lên : 20/02/2014, 12:20

6
388
0

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... yields three fractions which are denoted according to the proteins they contain. Fraction 1 includes all ‘non -nuclear proteins’, i.e. cytosolic proteins separated during hypotonic prepar- ation of nuclei, ... doi:10.1046/j.1432-1033.2003.03769.x functional complex, indicating a speci c in uence of O 2 -dependent cellular changes on critical steps of the assembly of a funct...

Ngày tải lên : 21/02/2014, 00:20

11
610
0

Tài liệu Báo cáo khoa học: "Adaptive Natural Language Interaction" potx

... for that description (e.g., about the monument’s ar- chitect) are dynamically included in the rules of the speech recognizer’s grammar, to increase word recognition accuracy. The rules include compo- nents ... generated descriptions vary dynamically, in both content and language expressions, depending on the interaction proﬁle as well as the dynamic interaction history. T...

Ngày tải lên : 22/02/2014, 02:20

4
303
0

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... for introduction of unmarked mutations in the genome of Paracoccus denitriﬁcans – construction of strains with multiple mutations in the genes encoding periplasmic cytochrome- C 550 , cytochrome -C 551 , ... cytochrome cd 1 , is necessary for the biogenesis of the d 1 cofactor [9–13]. In P. denitriﬁcans and closely related Para- coccus pantotrophus, these genes...

Ngày tải lên : 15/02/2014, 01:20

12
613
0

Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx

... Cell-cycle regulation is important in growth control, and therefore deregulation of the cell-cycle machinery has been implicated in carcinogenesis [57]. Cyclins and cyclin-dependent kinases (CDKs), ... up-regulation of CDK inhibitors, including KIP family members and INK4 family members Members of the KIP family can inhibit the catalytic activity of CDK2, 4 and...

Ngày tải lên : 16/02/2014, 09:20

11
611
0

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI ... (FWN 1 :5¢-TACCG TTAACATCGATATGCATCATCATCATCATCATAC-3¢), designed to introduce a ClaI restriction site at nucleotide position –6 and a reverse primer (REVN 1 :5¢-CCTGCC ATTGCTTGCAGCC-3¢) that in...

Ngày tải lên : 18/02/2014, 04:20

14
672
0

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... oligonucleotide (GL70, 5¢-biotin-CTC CAG TGA ATC CCA GAA GAC TCT GGA G-3¢; GL70mt, 5¢-biotin-CTC CAG TAG ATC TCA AGA GAC TCT GGA G-3¢) in binding buffer [50 mm Tris ⁄ HCl, pH 7.8, 100 mm NaCl, ... )272 and )13 (forward, 5¢-CCA TGG AGA CCA ACA CCC T-3¢; reverse, 5¢-CCC TGG GCT TTT ATA AGT CGT-3¢), or the human hsp70 gene between )1860 and ) 656 (forward, 5¢-TCT ATC TCT CGA TGG ATA CA...

Ngày tải lên : 18/02/2014, 06:20

11
584
0

Tài liệu Báo cáo khoa học: High-afﬁnity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx

... respectively. The lines in each graph (E, F) indicate the amount of binding predicted if the wild-type and mutant receptors are binding ligand independently. The tables indicate the amounts of the ... at 4 C. The lines in each graph (F, G) indicate the amount of binding predicted if the wild-type and mutant receptors are binding ligand independently. The tabl...

Ngày tải lên : 18/02/2014, 08:20

15
486
0