Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 Silvia Villamarı ´ n 1, *, Sylvia Mansilla 1, *, Neus Ferrer-Miralles 1 , Waldemar Priebe 2 and ... drug accumulated in the cells. Despite the slow uptake rate, the antiproliferative capacity of WP631 (measured as IC 50 after a 72-h continuous treatment) was...
Ngày tải lên : 20/02/2014, 23:20
  • 7
  • 581
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a-...
Ngày tải lên : 14/02/2014, 14:20
  • 14
  • 753
  • 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... Biochemistry, Department of Molecular Biosciences, The University of Adelaide; 3 Department of Medicine, The University of Adelaide, North Terrace, Adelaide, South Australia, Australia Vascular endothelial ... Adamis, A. P. & D’Amore, P .A. (1996) The mouse gene for vascular endothelial growth factor: genomic structure, definition of the transcriptional unit, and chara...
Ngày tải lên : 19/02/2014, 12:20
  • 13
  • 604
  • 0
Tài liệu Báo cáo khoa học: " A Refinement in Coding the Russian Cyrillic Alphabet" pdf

Tài liệu Báo cáo khoa học: " A Refinement in Coding the Russian Cyrillic Alphabet" pdf

... forms of characters that do not occur initially; by disregarding the diacritic of the character ё, and by disregarding the character ё entirely. Ambiguities that arise in the latter cases can ... desirable if each character of the Russian alphabet (together with any re- quired numbers, punctuation marks and capitals) could be coded in such a way that a separate u...
Ngày tải lên : 19/02/2014, 19:20
  • 3
  • 369
  • 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... of matrix sparse- ness can be minimized by reducing the dimension- ality of the matrix. An appropriate algebraic method that has the capability to reduce the dimen- sionality of a rectangular ... the first split would be located between frond and the rest of the vocabulary. In the case of sake the beverage sense is extremely rare in the BNC and therefore w...
Ngày tải lên : 20/02/2014, 16:20
  • 4
  • 536
  • 0
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... the other hand, Pf and Rf express the quantitative status of the morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of ... represent the distribution of population probabilities by means of G(p) with Z and to estimate the theoretical vocabu- lary size, and (ii) to interpolate and e...
Ngày tải lên : 20/02/2014, 18:20
  • 7
  • 593
  • 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Paola Turina and B. Andrea Melandri Department ... [34]) as a standard. The amounts of chromatophores and standard protein in the different lanes of a single gel were kept in the linear range of the luminol a...
Ngày tải lên : 21/02/2014, 03:20
  • 9
  • 580
  • 0
Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf

Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf

... might ‘Susi heard that Hans had an accident and might die’ • Categorial (phrasal and lexical) nodes — bolded in Fig. 1 — carry reference tags (pre- sumably propagated from the generator’s strate- gic ... E.g., the tag “7” is attached to the root and head nodes of both exemplars of NP Hans in Fig. 1, indicating their coreferentiality. For the sake of computational uniformit...
Ngày tải lên : 22/02/2014, 02:20
  • 4
  • 456
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteins are assembled in the bacterial outer membrane in a process mediated ... membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, rather than b-barrels. These proteins are usually predicted to ha...
Ngày tải lên : 19/02/2014, 07:20
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

... quenched-flow analysis reveals that ChlH dramat- ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... a higher available concentration of ChlM to bind other mole- cular species in the reaction. ChlH appears to enhance catalysis by accelerating the fo...
Ngày tải lên : 20/02/2014, 02:21
  • 8
  • 614
  • 0

Xem thêm

Từ khóa: