... How to remain nonfolded and pliable: the linkers in
modular a- amylases as a case study
Georges Feller
1
, Dominique Dehareng
1
and Jean-Luc Da Lage
2
1 Center for Protein Engineering, University ... bond
hydrolyzed has the theoretical capacity to disrupt a
hydrophobic interaction in the linker, inducing or
favoring its extension. As the catalyti...
... snippets, and generate
features for each tokens in the same way as done in
the training phase. We then use the trained model
to tag the snippets, and extract translation
candidates by identifying ... requiring minimal human
intervention to prepare the training data.
3 Method
To find translations for a given term on the Web, a
promising approach is automati...
... To amplify the DNA frag-
ments containing a complete x-5 gliadin gene, oligonucleo-
tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢
and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA
TG-3¢, were constructed based ... frozen
leaves by the Isoplant DNA extraction Kit (Takara Bio Inc.,
Shiga, Japan). PCR was performed using KOD DNA polym-
erase (Toyobo, Osaka, Japan) and DNA AMPLIFIER
MIR-D40 (Sanyo...
... an N-terminal
hexahistidine tag was obtained by PCR using the
pET2 1a ⁄ PNT-
H6
plasmid [30] as the template. The forward
primer (5¢-TACCGTTAACATCGATATGCATCATCATC
ATCATCATGC-3¢) was designed to ... hexahistidine
tag fused to its N-terminus was obtained by PCR from the
plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC
CTGGCCAATGAATATGCATCATCATCATCATCATA
CTCCGTCGACCCCACC-...
... to the N-terminal
protease domain, the carboxy-terminal domain of NS3
consists of an RNA helicase and NTPase activity.
NS 4A serves as a cofactor for NS3. The functions of
NS4B and NS 5A are largely ... of clinical HCV isolates is not as clear. Antibodies
against CD81 or recombinant CD81 had no or only a
marginal effect on the binding and internalization (as
measure...
... spatial and
temporal resolution for imaging neocortical functions in the liv-
ing brain, and has paved the way for a new era in the functional
imaging of cortical dynamics. It has facilitated the ... vaccine candidate was successful as vaccine in animal
models and is now in a clinical study. A proteome 2-DE database
was established (http://www.mpiib-berlin.mpg.d...
... calculated from
the intensity of the protein band.
Autoproteolysis in sample solutions containing <20
lgÆmL
)1
protein was followed by determining the residual
activity towards casein or the ... 300–
319 amino acid residues and are organized into two
domains. They have one catalytic zinc ion, and
between two and four stabilizing calcium ions. The
X-ray structures of therm...
... vector w, takes in a foreign sen-
tence f and returns a translated hypothesis h. The
argmax operates in vector space and our goal is to
find w leading to hypotheses on the Pareto Frontier.
In the ... dominating point.
ilar to many MT optimization methods. The main
difference is that rather than trying to maximize a
single metric, we maximize the number of pare...