‎2 4 a mosaic expression pattern in a cross section of the intestinal villi b c

THE SPATIOTEMPORAL STUDY OF ZEBRAFISH INTESTINAL EPITHELIUM RENEWAL

... Mosaic expression patterns of either side of an intestinal villus that is located at the margin of the donor embryo s and host embryo s derivatives (C) The bottom of the intervillus (proliferation ... generate chimeric zebrafish embryos and understand intestinal epithelium renewal in zebrafish 2 Materials and Methods In this study, Tg(β-actin:mGFP) was used as the donor embryo, and the host embryos ... and, Dr Kiyoshi Naruse, and Dr Nick Barker for gifting the fosmid and plasmid constructs To the staff and students in CBIS and MBI: Tong Yan, Dipanjan, Siew Ping, Keshma, Bee Ling, Hadisah, Al,...

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

Danh mục: Báo cáo khoa học

... histograms show stained cells, and black lines represent cells incubated with isotype controls Wild-type MSCs were analyzed at passages 3, 4, and (a) and IFN-gR KO MSCs were analyzed at passages and 12 ... and adipogenesis were induced as described previously [29] and [30], respectively) Anti-CD3-induced cell proliferation CD4 + T cells and accessory cells (ACs) were isolated from DBA/1 mice and ... MSCs (data not shown) These data indicate that IFN-g acts synergistically with IL-17 to upregulate expression of PD-L1, iNOS, and COX-2 in MSCs, making these molecules candidate mediators of...

Retrovirology Research BioMed Central Open Access In vivo expression of the HBZ gene of HTLV-1 doc

Danh mục: Báo cáo khoa học

... and wrote the paper; TM and KA provided clinical samples and assembled clinical database YS and JY provided clinical samples and performed experiments KS performed experiments, analyzed and interpreted ... by an investigator who was not involved in the patients' clinical care, and the neurologists who made the clinical evaluation did not have access to the laboratory data Statistical analysis The ... TGG AGA CTC CTC AA-3' and 5'-ATC CCG TGG AGA CTC CTC AA-3', and the probe was 5'-TCC AAC ACC ATG GCC CAC TTC CC-3' The sequences of primers for HBZ mRNA detection were as follows: 5'-AGA ACG CGA...

Báo cáo y học: " The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA" potx

Danh mục: Báo cáo khoa học

... out the molecular genetic studies, assisted by MJ LK conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript 18 19 Acknowledgements ... kit, Amersham Life Sciences) using goat anti-mouse or donkey anti-rabbit (Amersham Life Sciences) as a secondary antibody, and quantitated using UN-SCAN-IT gelTM automated digitizing system The sizes ... probed with anti-RT and antiCA are shown in panel B These data indicate that both full length GagPol and the truncated GagPol are incorporated into the viruses with similar efficiencies As previously...

Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx

Danh mục: Báo cáo khoa học

... and critical comments on the manuscript The assistance of Roland Jacob in preparation of the manuscript and Cornelia Gottschalk and Martina Hennicke in animal care is gratefully acknowledged ... acquired and GCV therapy was initiated (n = 7) GCV treatment did not cause any significant toxicity and treated mice displayed normal patterns of food intake and physical activity Control animals ... immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements We thank Hans-Dieter S ling for continuous support and...

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Danh mục: Tài liệu khác

... Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted using the Student s t-test Differences were considered ... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats ... medication is administered intravenously, its bioavailability is 100% When the standard consists of intravenously administered drug, this is known as relative bioavailability (BAR) The BAR of...

Tài liệu Báo cáo Y học: Identiﬁcation and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Danh mục: Báo cáo khoa học

... helper plasmid pKD46 Transformants were incubated h at 37 C and overnight at room temperature in SOC medium and then plated on Luria–Bertani agar plates containing kanamycin Kanamycin resistant (KmR) ... N-terminal sequencing The amino-acid sequences of proteins X and Y were identiﬁed in the Swiss-Prot databank as GatY and UP12, respectively GatY (D- tagatose-1,6-bis-phosphate aldolase of class II), is ... affected UspA expression also induced the synthesis of UP12 (CCCP and DNP) In contrast, other toxic compounds, such as H2O2 or CdCI2, at concentrations that affected synthesis of UspA [13] had...

Báo cáo khoa học: In vivo production of catalase containing haem analogues pot

Danh mục: Báo cáo khoa học

... using the bicinchoninic acid assay (Pierce Chem Co.), with BSA as the standard Concentrations of KatA were determined by the combined use of quantitative amino acid analysis (performed at the Department ... porphyrin-containing but metal-deprived (Cu-PPKatA, Mg-PP-KatA, and PP-KatA) catalases Fig Light absorption spectra of isolated normal and cofactorsubstituted catalases Porphyrins added to the growth ... puriﬁed iron-containing and gallium-containing catalases are presented in Fig 3A, B Fe-PP-KatA showed a Soret peak at 40 6 nm and weak absorption bands at 5 04, 541 and 625 nm These features are characteristic...

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Danh mục: Báo cáo khoa học

... experiments Thus, steady-state analysis can be used as a tool to establish the actual mechanism prevalent inside the cell by eliminating infeasible mechanisms The response curve can be quantiﬁed by a ... procedures We consider four candidate models, Models I–IV, shown in Figs 1–3, to validate the mechanism of induction of GAL genes by galactose In each of the models, cytoplasmic Gal3p is activated ... switch in S cerevisiae to demonstrate such an approach towards identifying the in vivo mechanism from a pool of candidate models We validate the mechanism by comparing the response of the model...

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Danh mục: Báo cáo khoa học

... gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; DEBHANSE, Debaryomyces hansenii; DROME, Drosophila melanogaster; KLULAC, Kluyveromyces lactis; SACHER, Saccharomyces ... (alias COMPASS) in Saccharomyces cerevisiae [8] This complex is implicated in leukemia [9] by covalent modiﬁcations of chromatin Results and Discussion Sequence analyses of all splice variants ... Ciona, Ciona intestinalis; Caeel, Caenorhabditis elegans; Caebri, Caenorhabditis briggsae The DIDO1 EST consensus sequence was reconstructed manually by assembling ESTs Boxed, vertebrate-restricted...

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Danh mục: Báo cáo khoa học

... Statistical analyses Statistical comparisons were performed by analysis of means using unpaired Student s t-test (two-tailed) All values are shown as mean ± standard deviation (SD) P < 0.05 was ... were thereafter determined by the Bradford protein assay (Bio-Rad, Hercules, CA, USA) using BSA as standard The distribution of radioactivity in the tissues was expressed as the ratio of c. p.m.Æmg ... lung Autoradiograms of separated liver and thoracic lymph node proteins revealed a radioactive band of 25 kDa in liver and bands of 30 and 56 kDa in thoracic lymph nodes (Fig 5C) No radioactive...

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Danh mục: Báo cáo khoa học

... TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary ampliﬁcation with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ ... 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined) Constructs containing a His- ... CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two ampliﬁed fragments...

Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deﬁciency and hypervitaminosis pot

Danh mục: Báo cáo khoa học

... humans suggest that high consumption of fruits and vegetables is associated with a reduced risk of chronic diseases including cancer and cardiovascular disease [30–33] Recently, it has been shown ... 5¢-ACAGCGATATCGAGACACTCA-3¢ (forward) and 5¢-GTGAGACACCAGAGTGCAAGA-3¢ (reverse); primers for p53: 5¢-CACAGTCGGATATGAGCATC-3¢ (forward) and 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1 : ... processed immediately Retinol and retinyl palmitate were measured in serum and tissues following the method described by Barua and Olson [16] Differential display analysis Liver RNA was isolated by...

Báo cáo Y học: In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis docx

Danh mục: Báo cáo khoa học

... [ 24] Lipid analysis Methyl heptadecanoate was added as an internal standard and the plasma membrane lipids were extracted as described [21] CLB-fatty acids were quantiﬁed by GC analysis An aliquot ... of octanoic acid [37] In this case, only Vmax was affected showing an increase that was accompanied by an increase in the presence of oleic acid in its plasma membrane lipids It must be noted ... data suggest that, although the particular fatty acid may be different for each species, activation of the plasma membrane H+-ATPase by increases in the unsaturation of the CLB-fatty acids is a...

Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc

Danh mục: Báo cáo khoa học

... the increased interest in miRNAs, and concerns that miRNAs are known to play important roles in clinical diseases, have attracted many molecular researchers to study miRNAs associated with the biogenesis ... and mature miRNAswas observed in cancer samples, compared with the correlation in normal cells This information indicates that the maturation process is controlled by an unknown regulatory factor, ... have the advantages of low background noise and high sensitivity However, these optical systems remain a distant goal for clinical application because of the optical signal attenuation by a tissue...

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Danh mục: Báo cáo khoa học

... degradation of NOS and HSP90 by calpain M Averna et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported are ... electroblotting, and immunoblotting analysis was performed as described above The immunoreactive material was detected and quantiﬁed as described above Assay of NOS activity NOS activity was assayed ... antibody The bands were then scanned, and the areas of the peaks obtained were used to create a calibration curve Immunoprecipitation Brain and thoracic aorta, excised from NMS rats, were lysed in...

báo cáo hóa học:" In vivo properties of the proangiogenic peptide QK" pdf

Danh mục: Hóa học - Dầu khí

... value less than 0.05 was considered to be significant All the statistical analysis and the evaluation of data were performed using GraphPad Prism version 5.01 (GraphPad Software, San Diego, California, ... neutral-buffered formalin solution and then embedded in paraffin All tissues were cut in μm sections and slides were counterstained with a standard mixture of hematoxylin and eosin [4] Quantitative ... 0.05, ANOVA) Capillary density was assessed on the tibialis anterior muscle of the ischemic HL by means of lectin istochemistry VEGF165 and QK increased capillaries to muscle fibers ratio in comparison...

Báo cáo hóa học: " In vivo evidence of htid suppressive activity on ErbB-2 in breast cancers over expressing the receptor" potx

Danh mục: Hóa học - Dầu khí

... ATT CAA TCA AGC TGC-3'(sense) and 3'-CCA GTG GAT CTT TTT CCA GAG -3'(antisense) and htid -S, 5'-CAG CCT CAG GAA GAA ACC ATC-3'(sense) und 5'-GGG ATC GTC ACG TTG ATC GTC-3' (antisense) according ... CAC TGG CAA AAC AAT GCA-3' (sense) and 5'GGT CCT TTT CAC CAG CAA GCT-3' (antisense) at an annealing temperature of 62 C Quantitative real-time RT-PCR analysis was performed using the ABI PRISM ... cases), random selected infiltrating ductal carcinomas (75 cases) and metastatic lesions (30 cases) Staining of these substrates with the affinity purified hTid antiserum [6,7,13] demonstrated...

báo cáo hóa học:" Function of anterior talofibular and calcaneofibular ligaments during in-vivo motion of the ankle joint complex" docx

Danh mục: Hóa học - Dầu khí

... processing and data analysis HR supervised data analysis and interpretation, advised co-authors in preparation and revision of the manuscript GL designed experiment, supervised data analysis and ... used as a reference in each comparison Data analysis A Friedman 's test was used to statistically compare the differences between the lengths of the ligaments at each tested position of the AJC ... involved lateral ankle ligaments. [4] Numerous studies have investigated the mechanical properties and simulated injury mechanisms of the ATFL and CFL in- vitro and much has been learned regarding...

báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

Danh mục: Hóa học - Dầu khí

... measurements, processed and analysed the FRF data (supervised by GVdP and SJ) and drafted the figures and the initial version of the manuscript GVdP and SJ conceived the principles of the vibration analysis ... the spatial distribution of contact areas was analyzed In a transient dynamic analysis [29] the successive steps in the insertion process were simulated in terms of contact areas and interface ... fracture may have been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25

‎2 4 a mosaic expression pattern in a cross section of the intestinal villi b c and d mosaic expression patterns of either side of an intestinal villus that is located at the margin of the donor embryo s and host embryo s derivatives