... expression control as measured by half-life Thirdly, a recent study found disordered proteins to exhibit high dosage sensitivity [5] We again find that this is a hallmark of flexible disorder (Figure ... weakly associated with this property Non-conserved disorder shows little or much weaker association with most of these features, suggesting that the functional hallmarks of this class are less obvious ... observed that within the set of the GI hubs (> 90 percentile in GI degree), disorder of the gene product is a strong predictor of multi-functionality (r = 0.22, P < 1012 ; Figure 1b) while this trend...
... the current frame In this case, the center of search window is not fixed and it is updated at each new frame to the center of the matched rectangle at the previous frame This approach is simple, ... some cross-movements There is no partial or full occlusion of the object in this case, but there are similar faces within the search window that complicate the tracking process As the results ... transformation as well as deformation, some pixels may disappear or appear within the bounding box, and hence it is not expected that in this situation any kind of object tracking algorithm will work properly...
... are considered as potential markers which could be associated with wood properties In this context, the aim of this study was to characterise the HD-Zip III transcription factor family and assess ... portion of the stem that we targeted in this analysis is also the part of the tree where petioles are actively developing and growing Approximately one-third of the misregulated genes (14 out ... HD-Zip III transcription factors This small family of regulators are known for their overlapping expression profiles and their functional redundancy The aim of this study was to develop insights...
... Different from all these mentioned, this research will focus the attention on the software vendor side The goal of this study is to investigate the impacts of this SaaS innovation on the performance ... Seidmann 2008), this multi-tenancy feature spreads the cost of servers over the clients who share this server (Sääksjärvi et al 2005; SaaS EC of SIIA 2006; Wikipedia.org) So this relationship ... subscription model This new software management model has been place great expectation on as a more efficient software business model and as a future trend of the industry This research uses...
... 264.9 Da) This shows that CTC contains two intramolecular disulfides For determination of half-cystine linkages, trypsin cleavage and identification of liberated peptides by MALDI MS was used This showed ... proSP-C [19] has a deletion in this region The non-Brichos part of CTC is readily cleaved by trypsin, which indicates that it is structurally flexible Interestingly, this segment is evolutionarily ... contributes to this behavior CTC binding to phospholipid vesicles resulted in the appearance of a reversible low-tempera- proSP-C structure and membrane interactions ture endotherm (Fig 8) This is consistent...
... families [22] In this study, we describe the purification, characterization and cDNA cloning of this allergen from Bermuda grass pollen Results from sequence alignment indicate that this newly identified ... contained IgE reactive with Cyn d 24 was about 65% in this study, which is higher than previously reported [5]; this is probably because the sera used in this study were from patients who gave a high ... first step of PCR cloning This experiment resulted in a cDNA fragment with an estimated size of 240 bp, which corresponds to the N-terminal portion of the allergen Based on this partial sequence,...
... Hydroxyethylthiazole (HET) ThiD (HP0844) ThiM (HP0845) Hydroxymethylpyrimidine pyrophosphate (HMP-PP) Hydroxyethylthiazole phosphate (HET-P) ThiE (HP0843) Thiamine phosphate ThiL (HP1291) Thiamine ... B subtilis is part of the thiazole biosynthetic operon, which includes a total of seven genes [1], whereas this is not the case for H pylori, in which ThiO, ThiS and ThiG are missing The tenA ... the thiamin precursor HMP and HET moieties Moreover, the two genes HP1290 and HP1291 could define a divergon with the gene coding for the TenA enzyme, located far away from genes ThiD, ThiM and ThiE,...
... conjugated with palmitate This suggests that even if Cys66 and Cys122 formed a disulfide bridge, it is not important for the structural integrity and stability of the Ag-NPA-1 molecule This was further ... [8] This finding applies to all the representatives of the family and suggests an important role of these proteins in importing essential lipids from the host Furthermore, worms could use this ... the NPA synthesis The immunohistological analysis in this study suggests that Ag-NPA-1 is distributed mainly in the pseudocoelom of A galli This indicates an additional function of the protein...
... characteristics and regulation of this apparent kidney-specific GLUT, in particular its physiological role(s) in relation to hypoxia adaptation and tolerance in fish Acknowledgements This work was supported ... include: a putative N-glycosylation site in extracellular loop 1; the STSIF motif in loop (the third S residue is substituted by an E); the PESPR/PETKGR motifs after transmembrane helix and 12; ... and 2; the coding region (1599 bp) is distributed across exons 2–12 and the 3¢-UTR is located within a 1238-bp stretch of sequence (corresponding to 3¢-UTR of 3014 Z Zhang et al (Eur J Biochem...
... coat MATERIALS AND METHODS Biologicals The solitary ascidian (Urochordata) Halocynthia roretzi type C was used in this study Sperm and eggs were collected from dissected gonads as described previously ... applied onto a glutathione±agarose column and washed four times with arti®cial seawater The GST±spermosin light chain fusion protein±vitelline coat complex was eluted from the glutathione±agarose ... glutathione± agarose chromatography, were mixed with the solubilized vitelline coat in arti®cial seawater After incubation at °C for h, the fusion protein was applied to a column of glutathione±agarose...
... ª 2011 FEBS S D Majumdar, PhD thesis submitted to AIIMS, 2010 This study This study This study This study This study This study This study 2137 Role of Lys182 in DevR function in M tuberculosis ... GGAAAGGACCAATCGCCTTATTCGTCA This study S D Majumdar, PhD thesis submitted to AIIMS, 2010 This study This study [27] S Ghosh, M Biotech dissertation, AIIMS, 2008 This study This study This study or mutant) ... This regulator has been proposed as a key participant in the dormancy programme of M tuberculosis and consequently it is potentially important as a target for novel drug development [14,15] This...
... and acidic RNases [13], and a third poly(U)- and poly(C)-specific ribonuclease has also been isolated and characterized [14,15] In order to further characterize this poly(U)and poly(C)-specific ... adult tissues, a fact that strongly indicates a basic housekeeping cellular role for this ribonuclease [18] This paper reports the identification, isolation and characterization of a novel Cc RNase ... stability [24,25] For this reason, we further investigated the existence of regulatory elements in the 3¢ extended UTR of the longer transcript An extensive analysis revealed that this particular region...
... the complex between HAKN1 and its target site This model must be applicable to all KNOX homeodomains, as important amino acids are conserved within this family Results Expression and DNA binding ... For both strands, the highest protection is observed within the GAC core, suggesting that the protein makes closer contacts in this region This agrees with the important role of these nucleotide ... with this sequence and which amino acids are involved in sequence-specific contacts To answer this, we have analysed the effect of single-site mutations on HAKN1 binding to TGACA and variants of this...
... denominator correspond to identical samples, this expression is independent of the amount of protein loaded The method is described more fully in Contin et al [14] Within a particular independent experiment, ... clarify this point, we investigated the enzyme activity associated and nonassociated with microtubules in cells treated and nontreated with OA Since the detergent-extracting method used in this ... of the soluble fraction, determination of carboxypeptidase activity in this fraction was not possible Therefore, to perform this study we disrupted cells under microtubule-stabilizing conditions...
... can regulate the promoter activity and endogenous KCTD10 expression oppositely through binding this region SP1 and AP-2a regulate KCTD10 Results Analysis of genomic structure and identification ... underlined produced 17.5-fold higher luciferase activity compared with the control pLuc vector Taking this as a 100% base, deletion from )609 to )343 showed a 7.4% increase; construct P ()609 ⁄ )241), ... deleted, presented almost no promoter activity; by contrast, construct P ()241 ⁄ +30) containing this 271 bp of the 3¢-end showed only a 8.7% increase These results suggested that the functional...
... element in this region This negative element was termed NEG-U The F-233 construct still directed reporter gene expression to a great degree, and some essential elements might be responsible for this ... suppressor [22], and the c-fos and c-myc oncoproteins [23] This activity is due to its capacity to bind to the consensus sequence within the promoters of these target genes Furthermore, Pokemon ... importance of combinatorial control In this study, we also found that mutations in both NEG-U and NEG-D elements had the same effect as each single mutation This is because negative regulation of...
... sequences were deduced from the genomic sequences (this study) in this group suggests that it might be involved in similar biological functions Within group I, the APs At1g11910 and BnU55032, GmSoyAP1 ... similar or complementary biological functions Interestingly no dicotyledonous plants were found within this group (Fig 5) Finally, group III contains the tomato (L46681) and potato (StAsp) APs, whose ... it became evident that our previous work did not allow discrimination of these genes [3,6] Within this context, we had designed primer pairs specific for each cardosin gene (Fig 6A) and evaluated...
... C-termmus Mickey Barber obtained a perfect El spectrum of this 1359-Da peptide and was able to interpret the spectrum (4) 1believe that this, at that time, was the largest natural compound ever ... the real breakthrough for this techmque came years later with the simultaneous discoveries of the advantages of using nitrocellulose as support (2 2) or reduced glutathione as matrix (12) Shortly ... I will try to use the way of thinking and argumg I have experienced m my dtscusstonswith Mickey to outline what I consider to be the main function of the matrix This 1s independent of whether...